Perhaps the most important discovery of the
twentieth century was to learn to identify and read
the code of life.
And perhaps the most important challenge we
will face in the twenty-first century … is
how … and when … to apply this knowledge.
(Harvard, with its classic modesty, has located its biochemistry, genomics, and molecular-biology labs just off Divinity Avenue.)1
It took nearly a century and a half to start to read the language that determines all life processes.
In the 1850s, an Austrian monk,
Gregor Mendel,
began experimenting in the garden of his monastery.2
He used the pollen of some plants to carefully fertilize other plants … Mostly peas.
By carrying out these experiments deliberately and carefully recording the results, Mendel was able to observe that various traits present in grandparents, mothers, and fathers could be passed on to offspring …
And he could catalog which traits tended to dominate …
Thus giving rise to a new discipline …
Which we now call genetics.
But no one paid much attention to Mendel’s discoveries until almost a half century after he began experimenting (sixteen years after his death).
Over the course of the twentieth century …
Scientists gradually realized the importance of Mendel’s work …
And began conducting their own experiments …
And drawing their own conclusions …
For better … or worse.
Doctors noted that some diseases attacked some grandparents,
children, and grandchildren.
Disease could be inherited …
And could sometimes be statistically predicted …
So today, many genetic diseases can be prevented, or treated.
But there were also those who used genetics to create a pseudoscience …
Eugenics.
They drew the wrong conclusions … and used them to justify racist laws.
They believed there were superior …
And inferior …
Races.
(A wonderful book titled The Mismeasure of Man shows how even “objective scientists” could misreport measures of cranial size if they expected to find racial differences.)3
Hitler loved eugenics …
He used the concept to justify …
The murder of millions …
Because they were not part of a “chosen race.”
Then again … from 1901 through 2000, the constitution of Alabama read, “The Legislature shall never pass any law to authorize or legalize any marriage between any white person and a Negro, or descendant of a Negro …” This law was finally abolished through a referendum in November 2000. Still, 40 percent of voters … over 544,000 people … voted against this change.)
(P.S. Alabama is not alone … In 2000, South Carolina’s government was racked by a vigorous debate because the Confederate flag was still flying over the State House, and many African Americans considered this an insult … State senator Arthur Ravenel responded by referring to the NAACP as the “National Association of Retarded People” …)
Genetics is a very powerful instrument …
So we all have a stake …
And a reason …
To understand …
And participate …
In debates …
As to what we should …
And should not do …
As we study and alter …
The code that governs …
All life on the planet.
(Not that this is without controversy … There is a growing movement, particularly in Europe, against genetic engineering … Various organizations and individuals have taken a strong stance.)4
Genetic knowledge helps keep most of us alive.
In 1804 there were one billion people on the planet … 1927
two billion … 1999 six billion …
We would have starved long ago …
If agricultural productivity had not increased much faster than population.
The grains and animals we eat today … are “unnatural.”
We have been modifying the genetics of foods for a little while.
(Although we have been around for close to 1.8 million years … we started systematic cultivation only in the last 11,000 years.)
Most foods we eat today are the result of careful breeding and cultivation …
Particularly of a very few species.
Of over 200,000 plants, only a dozen account for 80 percent of all crops.5
Many of today’s staples were once inedible or hard to eat …
“Natural” tomatoes are small green berries …6
WILD PERUVIAN TOMATOES …
(L. hirsutum)
Are small … Green … Slightly poisonous.
Kidney beans can be poisonous if undercooked …7
“Natural” corncobs are … the size of your fingernail … Covered with irregular … multicolored kernels … that drop off easily.
Most of the flowers and fruits in our houses are artificial hybrids …
And “natural” dogs … are wolves.
Most genetic “engineering,” so far, has been haphazard …
Through 1953, we had little idea how heredity was coded …
Much less how to read it in detail.
Then a young scientist, James Watson, and an orthodox British professor, Francis Crick, discovered that the traits we inherit from our ancestors depend on a complex molecule with an unpronounceable name …
DEOXYRIBONUCLEIC ACID.
(We know this compound by its shorthand … DNA.)8
DNA contains the code of all life processes …9
Bacteria, worms, fish, birds … Humans …
Each plant, animal, or bacterium carries its entire genetic code …
Inside almost every one of its cells.
The structure of each molecule of DNA is like a ladder …
The sides of the ladder are built with sugar and phosphate.
Four substances—adenine, thymine, cytosine, and guanine—form the rungs of the ladder.
Because DNA is a very large molecule …
And it would be endless to write out time and again the full name …
Of each base pair that forms a rung on the ladder …
Scientists simplify their notations into A, T, C, and G.
Like humans …
The amount of information carried and processed …
To preserve life functions is staggering.
If we stretched out the DNA contained in each of our cells …
It would be about six feet long (… but it folds up into trillionths of an inch).
OUR GENETIC CODE CONSISTS OF
THREE BILLION LETTERS
(A, T, C, and G) …
AND THIS CODE IS REPLICATED TWICE WITHIN …
EACH ONE … OF OUR
FIFTY TRILLION CELLS.
(But before you get too excited by “this wondrous machine called man” … Remember that an ear of corn has 2.6 billion base pairs, and wheat more than 16 billion.)
By 2000 we were able …
To read the entire genetic code of a human being …
Otherwise known as the human genome.
Writing down on paper a copy of the genome we carry within each of our cells …
Would require the equivalent of 248 Manhattan phone directories …
A typical paragraph might read:
AAATTCCTTTAGGGATTTAGGCCCCTGAGAAAATCCGGCCC-CGCCTCCTAGAGATCTCGATATTTAGGGGGATTTGGGGCC-CATTTTAGGGGGATTATTATATAAATACCCCTATATATAAAAAGAGGATTTTCTTCCATACTTTTCCTCCAAAATTTTGGGGGCCCAT-TATATTTTAAATACTTCCCTGTAATGTTGGAGGAAATATTTG-TAAATATAATATAAAGAGATTTATATATTAGAGAGAGGCCAG …
IF SOMEONE SPENT HER ENTIRE LIFE READING A COPY OF ONE PERSON’S GENOME … SHE WOULD BARELY FINISH … MUCH LESS UNDERSTAND … OR REMEMBER … WHAT SHE READ.
But it is important to know what one is reading.
A word can mean very different things depending on …
The letters used …
The order of the letters …
And where these letters are placed within a sentence.
Similar letters can have very different meanings …
One’s constitution is not the same as a nation’s constitution.
Even the same letters can have different meanings …
“letsgotogether” can mean “let’s go together” or “let’s go to get her.”10
The same is true of a computer program.
If one writes 00101111, the computer divides two numbers, whereas if one writes 00101010, it multiplies.
And the same is true of DNA.
If science or nature substitutes one string of ATCGs for another (particularly within a section of DNA that codes actively),
The organism may be drastically altered.11
Small variations within a genetic code can have enormous impact.
We have only one-third more genes than a worm …
Around 99 percent of your genes have partial counterparts in mice …
(No wonder some people act like rats.)
So scientists test various medicines and procedures on mice and other animals …
Before attempting to treat humans.
By the time we get to bonobos (pygmy chimps), the gene overlap with humans is about 98.5%. 12
(Something that becomes obvious when one deals with certain politicians … Not surprising, given that we began speciating from the great apes about seven million years ago … and began giving up a nomadic existence only in the past 13,000 years.)
The variation between your genome and that of your brother, neighbor, worst enemy, or that of any other person on the planet is minuscule.
Of every thousand letters of genetic code, we differ from our neighbor by less than one letter … That is, by less than one A, T, C, or G base pair.
And because only a few regions of our total DNA actively code life functions …
The real differences between one person and another are less than 0.0003 percent.
(Chimps have a more varied genome, because they have been around a lot longer than humans. Two animals taken at random from Africa have at least four times more mutations within their genomes than humans.)13
But minute changes in a genome are enough to make some tall, others short, some fat, some slim, some blond, others redheads.
They are also enough to make some healthy and others very sick.
A few letters’ difference can make a difference in who lives a long time …
And who does not.
Some diseases attack everyone who lives in the same environment …
Others do not.
Sometimes only one child, or a few grandchildren, or one in five neighbors, comes down with a specific disease.
Often the difference in whether one gets cancer or not …
How violent the cancer is …
Depends on minute variations of the letters within our genetic code. 14
For example, women who carry a specific genetic variation known as BRCA-1 are seven times more likely to get breast cancer. And this cancer is likely to occur earlier in life and be more malignant.15
Even three letters out of three billion can make a huge difference.
If you are missing CTT at a specific spot in your genome …
You carry cystic fibrosis.16
(But beware … Genes are not necessarily destiny. Eric Lander, head of MIT’s Whitehead Institute, likes to point out that there has been enormous variation in how humans govern themselves, make money, think about ethics or war … even though there has been very little variation in the human genome. Your environment and the choices you make are at least as important as your genes.)
As we get smarter about why one person gets sick and another does not …
And how to prevent and cure certain diseases. The consequences are significant.
A child born in 1900 in the United States had a life expectancy of 46 years …
By the end of the century it was 78 …
Close to a 70 percent increase …
And genetics is likely to increase this life span significantly.
The types of diseases people die from today are quite different from those of a century ago.
(In 1900, the three leading causes of death in the United States were pneumonia, tuberculosis, and diarrhea. Today, they are heart disease, cancer, and stroke.)
One rarely sees mass epidemics (besides AIDs) …
Instead, more and more people fall victim to gradual degenerative diseases …
Like arteriosclerosis, Alzheimer’s, and cancer.
If, how, and when one gets these diseases depends in part on genes …
And in part on one’s lifestyle.
Smoking, for instance, can trigger gene mutations and lead to cancer.17
How long you …
Your children …
And your grandchildren …
Live …
Depends increasingly …
On understanding the human genome …
And on understanding …
The genetic code of the organisms that attack our bodies.
(Substituting a single G for an A inside the three-million-letter malaria code could kill you … Substituting a single amino acid inside one of your proteins can lead to sleep deprivation.)18
Bill Haseltine, founder of a company called Human Genome Sciences …
Is a smart, tough, controversial scientist …
Who is absolutely determined to prove …
That our body contains a medicine chest …
Full of substances that heal wounds, fight infections, mend broken tissue.
Haseltine believes that understanding the genes that allow us to heal ourselves …
Will provide the most powerful medicines in the future …
And will allow us to live 120 years …
Before we start regenerating our own tissues …
After that, we may be “young and healthy forever.”19
(Haseltine has never been accused of shyness … nor have many of the scientists leading the gene revolution … Perhaps this is why The Scientist wrote that the genome is an anagram for “ego men.”)
But before you dismiss Haseltine as another optimistic quack …
Or assume this is just science fiction …
You might consider that …
Haseltine is one of the United States’ leading AIDS researchers …
CEO of a major pharmaceutical company …
(And you might also consider that Haseltine’s company has applied for 9,200 patents.)
Remember that in developed countries today …
Communicable diseases kill only 15 percent of the population.20 Many women are expected to live ninety years …
Because they have fewer accidents and are less prone to fight than men.
And that many of us can hope to live to be over 100 …
Something that would have been almost unthinkable at the beginning of the twentieth century.
Sarah Knauss used to have an unusual family photograph on her dresser …
She was surrounded by her family …
A ninety-six-year-old daughter …
Her grandson (seventy-five) …
Great-grandson (forty-six) …
Great-great-grandson (twenty-four) …
And a three-year-old great-great-great-grandson …
Sarah died when she was 119.
These photos may become more common …
In September 2000, Science reported that two drugs, antioxidants …
Could increase the life span of nematode worms by 50 percent …
The first example of a drug used to slow aging.21
Our children will likely …
Be running on the beach well into their nineties …
Powered by replacement body parts …
That come from a variety of people and are grown in various countries.
The ability to understand and cope with basic public-health issues …
Makes a critical difference in a country’s future.
HOW THE WORLD LIVES AND DIES22
(disability-adjusted life years)
| 1900 | 1990 | 2020 |
|---|---|---|
| Communicable | Flu | Heart disease |
| diseases | Diarrhea | Depression |
| were the | Pregnancy problems | Road accidents |
| leading cause | Depression | Strokes |
| of death | Heart disease | Chronic pulmonary disease |
| Chronic non-communicable diseases will cause 73% of deaths |
Some countries have done a good job improving basic health care. Between 1982 and 2000, China’s population increased 19 percent …
But the number of people over sixty increased 72 percent.
MEANWHILE, IN ZIMBABWE …
THEY TRAIN THREE EXECUTIVES FOR EACH JOB …
BECAUSE TWO MAY DIE …
OF AIDS.
SOCIETIES AND PEOPLES WHO UNDERSTAND THE GENETIC ALPHABET …
ARE LIKELY TO LIVE LONGER …
AND GET RICHER.
(Sounds simple … But remember what Monty Python sort of said … A dictionary has all the words contained in every work of literature … Therefore all Shakespeare had to do was to get the right number of words … in the right order.)
But most societies do not understand genetic discovery …
Or the challenges that arise from these discoveries …
And that makes them, for all practical purposes …
Functionally illiterate …
In the language that codes all life on this planet.