The first explosions were heard on this island in the evening of 5th April, they were noticed in every quarter, and continued at intervals until the following day. The noise was, in the first instance, almost universally attributed to distant cannon; so much so, that a detachment of troops were marched from Djocjocarta [Yogyakarta], in the expectation that a neighbouring post was attacked, and along the coast boats were in two instances dispatched in quest of a supposed ship in distress.
Sir Stamford Raffles
IT WAS NOT GUNFIRE but something much more deadly. In 1815, Sir Stamford Raffles was Governor-General of the new British colony of the Indonesian island of Java and 350 miles to the east, a world-shaking catastrophe was taking place. In the most devastating and powerful volcanic eruption in recorded history, Mount Tambora blew itself apart. Inside the cone, pressure had been building in a huge magma chamber and on 10 April it exploded. The roar was heard 1,600 miles away on Sumatra and Raffles was astounded by what he saw, writing that Tambora became ‘a flowing mass of liquid fire’. The top half of the volcano had simply disappeared, shattered into smithereens by the ferocity of the eruption, reducing its height from 4,300 metres to 2,851 metres. At least 11,000 people were reckoned to have been killed immediately. Governor Raffles sent Lt John Phillips to Sumbawa, the site of the ruined volcano and he left these notes:
On my trip towards the western part of the island, I passed through nearly the whole of Dompo and a considerable part of Bima. The extreme misery to which the inhabitants have been reduced is shocking to behold. There were still on the road side the remains of several corpses, and the marks of where many others had been interred: the villages almost entirely deserted and the houses fallen down, the surviving inhabitants having dispersed in search of food …
Since the eruption a violent diarrhoea has prevailed in Bima, Dompo, and Sang’ir, which has carried off a great number of people. It is supposed by the natives to have been caused by drinking water which has been impregnated with ashes; and horses have also died, in great numbers, from a similar complaint.
Tambora’s effects across the Indonesian archipelago were devastating. Large fragments of pumice rocketed into the air, some measuring 20 centimetres across, and killed people as they fell. An ash plume formed and descended in a radius of 800 miles while a tsunami tore into the surrounding islands. Trees were uprooted on Sumbawa and catapulted into the sea where they mixed with cooling and solidifying pumice to create an extraordinary phenomenon. Vast rafts, some of them three miles across, were driven out into the Indian Ocean by the tsunami and, five months after the eruption, one drifted onshore near Calcutta.
The wreckage and carnage was not confined to south-east Asia. Many thousands of tons of sulphur exploded from Tambora into the upper atmosphere along with huge clouds of superfine volcanic ash. They combined into an aerosol screen and stratospheric winds carried this toxic mixture great distances. It altered the Earth’s climate profoundly. In the spring of 1816, a ‘dry fog’ blanketed the north-eastern United States; in June snow fell in New York State, frosts bit hard and, across a huge area, crops were ruined, left black and rotting in the ground. Across the northern hemisphere, animals died in their millions, famine followed and the extraordinary climate is thought to have been the cause of a typhus epidemic which raged along the Mediterranean littoral and south-eastern Europe. Appalled observers wrote of 1816 as ‘the year without a summer’.
Known as a super-colossal eruption, Mount Tambora was more severe than Krakatoa or any other recorded volcanic event in the last two millennia. But its effects were short-lived and mild compared to what happened 70,000 years before on the island of Sumatra 1,800 miles to the north-west. More than seventy miles long and twenty miles wide, the placid tropical waters of Lake Toba now fill the vast crater of what geologists call a super-volcano. The eruption of Toba was two orders of magnitude greater than Tambora and the most severe in the last twenty-five million years. It changed the world and directly affected our ancestors, their DNA and the long journey it eventually made to Scotland.
Toba took place too long ago for any description to have survived except in the geological record but it appears that the nature of its impact was similar to Tambora albeit on a much greater scale. The supereruption plunged the planet into a six-to-ten-year volcanic winter. Little or no sunlight could penetrate the dense and persistent sulphuric aerosol and, as the skies darkened over continents, plants withered and died. A blanket of ash fifteen centimetres thick covered the whole of the Indian subcontinent. With nothing to eat and water contaminated, animals died in their millions – and populations of people, of Homo sapiens, appear to have teetered on the brink of extinction.
Scientists believe that Toba left only a tiny group, perhaps just five or ten thousand people, alive and it seems that they survived in a Refuge in the rift valleys of Central Africa. There may have been as few as a two thousand able to conceive and give birth – and we are all of us the descendants of this tenacious remnant.
Their DNA is our DNA and how it was structured, how it mutated and how it changed over time are the key texts in understanding the genetic journey of the entire human race, in being able to read the Book of the Dead.
In the autumn of 1951, two brilliant scientists began to work together at Cambridge University. Within two years, the collaboration of Francis Crick and James Watson had created a convincing model for the molecular structure of DNA. It was a double helix – two long strands of chemical bases forming a spiral and linked in pairs, like the steps of a spiral staircase. Crick and Watson had made a world-changing discovery; understanding the structure of DNA quickly led to a clear sense of how it worked.
DNA or deoxyribonucleic acid is one of the central building blocks of life, the hereditary material in human beings and almost all other organisms. Even though every cell in the human body has the same DNA and most people’s DNA is very similar, it is nevertheless the key to individual identity, to understanding the differences between us and how our history across the planet diverged and coincided.
The information in DNA is stored as a chemical code made up from four bases: A is adenine, C is cytosine, G is guanine and T is thymine. Like the letters making up the words on this page, the code is the order of the chemicals in the DNA strand. When they are written out, these letters make a sequence – for example, ggaacagattttaccacccaagta. Each person carries two copies of the code, one inherited from their mother, the other from their father, and they are joined together in the double helix. In total, there are six billion letters, three billion from each side of the family. About 99.9 per cent of these are the same in all people everywhere and they collectively identify us as human beings. But there are tiny marginal differences or mutations and they are what make us very slightly unlike each other. For instance, rather than carrying the ggaagcatttgggtacagta sequence, another person might have a thymine instead of adenine for the fourth letter, giving ggatgcagatttgggtacagta. This change might arise when the process of reproduction copies all of these millions of letters to make new DNA for the next generation. Depending on where in the DNA sequence a change occurs, it may have no effect since much of it appears not to be critical to our lives as it is endlessly copied into the future. It seems to work like a kind of harmless parasite inside our bodies. But, when a change does occur in a critical place, a devastating disease can be the consequence. All changes, benign and malign, are inherited and they form a chemical archive of our history, from family trees to the origins of humanity.
Studies from DNA populations around the world have revealed how similar all humans are compared to, say, fruit flies or chimpanzees. This is because humans are a very young species and there has been less time for changes to occur. People like us first come on the archaeological record in Africa about 150,000 years ago, a mere moment in evolutionary time. Other species are millions of years old and they have had time to mutate and change over a very much longer period. For example one troop of 55 chimpanzees carries more genetic diversity – more differences in their DNA letters – than the entire human race of seven billion people.
It is important to understand that African DNA is special. It is more diverse than non-African DNA so that, in any sequence of letters, more changes, more variants are found in Africans. The reason for this is straightforward – humans have lived in Africa for much longer than anywhere else and there has been more time for these changes to happen and to spread.
This comes into focus when two crucial elements of our DNA are studied – the Y chromosome and mitochondrial DNA. The Y chromosome is what carries the gene to create men. The default embryonic programme is for all of human reproduction to create only females but the presence of the SRY gene on the Y chromosome initiates a cascade of events leading to a different outcome. Only men carry the Y and it is passed on by fathers to sons and grandsons and so on down the generations. And, crucially, because there is no female Y chromosome, it does not become mixed or diluted in succeeding generations like the rest of our DNA.
From a geneticist’s point of view, this is extremely helpful. It means that a sixty-million letter block of DNA is inherited through the male line intact, from generation to generation. Many changes can be found in one sequence and therefore many different types of Y chromosomes can be identified. And, moreover, the relationships between these different types can be recovered by looking at the pattern of sharing of the different changes. For example, two Y chromosome types sharing ten variants are obviously more closely related than they are to a third lineage with the same ten variants but an extra one that neither of the first two have.
Mitochondrial DNA (mtDNA) is the counterpart of the Y chromosome and it is passed on by mothers to their children. Sons have it but do not pass it on, their mtDNA dying with them, but daughters always pass it to granddaughters and so on, like men do with the Y chromosome. Mitochondrial DNA does not mix with other DNA and is therefore also inherited intact, preserving the clear relationship between lineages. Seminal work in the 1980s with mtDNA first revealed our recent African origins but, because it has fewer letters than the Y chromosome DNA, the latter can provide much more information about our past.
When the early communities of Homo sapiens in Africa were decimated some time around 70,000 BC and the supereruption of Toba, a tiny number of survivors detached themselves from the main remnant groups and began to move north from the rift valleys. What prompted the exodus may have been the devastation of the volcanic winter and the shrivelling of plant and animal life even in the warmth of Africa. In any event, it seems that only a few hundred people took the first steps on an immense journey, one which would ultimately populate the whole of the rest of the world.
When the exodus bands reached the Horn of Africa, they crossed to the Indian Ocean coast of the Arabian Peninsula. The Bab el-Mandeb, the Gate of Tears, that leads into the Red Sea is only ten miles wide between modern Djibouti and the Yemen but, even over that distance, boats will have been needed to gain the farther shore.
Over each new horizon, they carried the secrets of their DNA inside them and, as they crossed rivers and mountain ranges, it seems that only two mother-line lineages and two father-line lineages survived the privations of their great journey. All of the human beings who are not Africans or are not descended from Africans are their children. These pioneer bands left behind a much more diverse group. African DNA has about twenty mtDNA lineages and approximately ten more Y lineages which can be traced back to the time of the exodus.
Physical characteristics show African diversity very clearly. While Europeans believe themselves to look very different from Chinese, Korean or Japanese people, for example, Africans are much more different from each other. In the south, the San peoples, the bushmen of the Kalahari, are small hunter-gatherers who were displaced by the Zulu and Xhosa from the north, groups who looked strikingly different – taller, rangier and with a very different culture. The pygmies of the jungles of Central Africa are perhaps the most extreme example of a variant.
As the pioneers reached the Persian Gulf, some appear to have swung northwards to the lands watered by the rivers Tigris and Euphrates. The region that used to be known as Mesopotamia was the place from where human beings, Homo sapiens, eventually began to move into Europe and mid-Asia. DNA shows both the pace of this migration and has something to say about the people who began to walk to the west – and a remarkable encounter.
Recent research has revealed startling new information about human DNA. When the bands of pioneers from Africa reached Mesopotamia and the Levant around 60,000 BC, they encountered groups of Neanderthals – and they mated with them. Scientists at the Max Planck Institute in Leipzig have sequenced the whole Neanderthal genome from the powdered bone fragments of three females who lived in Europe around 40,000 BC. They then compared their DNA with the genomes of five people from France, China, western Africa, southern Africa and Papua New Guinea. There was no correlation with the two sets of African DNAbut, sensationally, it became clear that between 1 per cent and 4 per cent of the DNA of the non-African lineages comes from the Neanderthals. The wide geographical spread of the non-African samples strongly suggests that Homo sapiens mated with Neanderthals in Mesopotamia before the dispersal along the Indian Ocean coast to Australasia as well as to Europe and eastern Asia.
The analysis gave no information on whether or not Neanderthals living in Europe 20,000 years later interbred with our European ancestors but there is currently no evidence of this from mtDNA, Y chromosome or other kinds of DNA. Nevertheless, these new findings do mean that most Scots will have inherited a small but variable proportion of their genes from these ancestral Neanderthals of the Near East.
The peopling of Eurasia as inferred from mtDNA variation. The bold black arrow indicates the rapid southern coastal migration from the Horn of Africa to Australasia. After initial colonisation three expansion zones are highlighted where the mtDNA types indicated arose, and from where they later spread to the interiors of the continent (smaller arrows). The ancestors of the Scots moved from SW Asia to Europe across the Bosphorus at various times in prehistory. Although not shown here, some rarer groups, such as Y chromosome M35 left Africa later via a Northern, Levantine route.
It is clear that those men and women who hunted the megafauna before the last Ice Age, who attacked and brought down their prey, who may have used their teeth as savage weapons have played a role in our common human ancestry. Perhaps we should be careful when we mock them. They were brave and hardy – qualities most would hope to inherit.
DNA can trace the footprints of the dispersal out of Africa as people with a particular and identifiable lineage found good places to live. Some decided to stay in a location like Mesopotamia, for example, where they could hunt and gather food while others eventually moved on.
Movement along the Indian Ocean coast was very rapid and within only 2,000 years pioneer bands had reached all the way to New Guinea and Australia. Because of this, there are very old lineages in south-east and south Asia.
By contrast, there appears to have been a pause, perhaps as long as 20,000 years, before bands began to move out of the Near East towards Europe. Perhaps the way to the west and north was blocked by wide swathes of desert.
As the footprints of Homo sapiens stamped themselves on the map of the world, their DNA maintained a link with the places their ancestors had been before them. These connections can be seen very clearly when comparisons are made. Each region has a set of predominant lineages which might be said to be characteristic of that place and some of these are clearly very old – even original.
The statistics of historical genetics are very straightforward in this regard. The origins of a particular lineage or marker can be ascertained when two related factors are taken into account. First, geneticists look at distribution. Where in the world is the marker most common? Where do most of its carriers live? Second, the number of mutations amongst these populations is counted. If there are more than in any other place where the marker is found, then that means it has been in that place for the longest time.
When such lineages turn up elsewhere, it is possible to see in the example of a single person how far the exodus out of Africa reached and the various routes it took. There is a farmer on the Hebridean island of Islay who was astounded to be told that his DNA was linked in a direct line with an ancient Y lineage in Mesopotamia, modern Iraq. In the genes of the farmer and his sons, the story of an immense journey still lives.
When a scientist analyses a sequence of DNA letters, A, C, G and T, in any two individuals, they will see that some are identical but that others have differences, perhaps fourteen letters out of the first seven hundred. These arise from errors in genetic copying – that is, in the production of sperm and eggs. With three billion letters from the mother and three billion more from the father to replicate in each generation, it is inevitable that such incidental copying errors will occur. And it is just as well that they do, for these differences are the raw material for understanding evolution and the DNA history of the human race.
Using what is known as the ‘molecular clock’, geneticists can measure the pace at which changes in DNA sequences of letters occur. Over long periods, mutations appear to take place at regular intervals and this, in turn, allows approximate dates to be attached. When the occurrence of these mutations is calibrated against other data such as archaeological finds or fossil records, the chronology becomes more secure. For example, the chimp–human divergence occurred about six and a half million years ago and so provides a calibration point for the rate of change. This process underpins any clear understanding of the dating of genetic history.
One of the most ancient Y lineages in Scotland is known as M284 and it accounts for about 4 per cent of all Scottish men, a group of around 100,000. And it is a living link with the cave painters of the Ice Age Refuges. When the weather warmed after 12,000 BC, some of these men walked north and crossed dry-shod into the European peninsula that was Britain and they carried the marker M284 with them. It developed a later subset called S165 which is essentially only found in the British Isles and which charts the progress of these pioneers. S165– is the older subset and it is more widespread and more common in England while the younger S165+ is more common in Scotland.
Examples of this marker are also seen in Ulster, not only amongst plantation families (migrants from Scotland and elsewhere, most of whom arrived in the seventeenth century) but also in those of older pedigree. This shows an ancient connection across the North Channel. It is very likely that S165 arose somewhere in the British Isles and shows a degree of commonality between some Englishmen and some Scotsmen, probably a memory of an ancient shared British ancestry.
M284 is very rare outside the British Isles and Ireland but it is found in tiny numbers in France and Germany. Analyses of Portuguese samples have revealed a significant number of M284 chromosomes at higher frequencies than anywhere else on the continent. This points to a possible Iberian origin, perhaps groups leaving the Ice Age Refuges and moving westwards and south.
Mitochondrial groups H5, U5b1, H1 and V all appear to have originated in south-west Europe and to have moved after the end of the Ice Age between 11,000 and 13,000 years ago. Each has both its highest frequency and diversity in this part of Europe and it become fainter as traces radiate outwards. Both the Y and mt groups account for a significant proportion of Scottish lineages and they have deeper origins in the Near East.
What this analysis shows is something simple and unarguable. Some of the earliest Scots were the direct descendants of some of the earliest people to reoccupy England after the last Ice Age and both have close links to the people of the western Refuges.
18,000 years ago – the peak of the last ice age. Scotland and the north of Europe were covered in thick ice, with tundra to the south. Park tundra is a slightly less extreme form of tundra, with low grasslands and alpine flora. Humans could only live in the southern parts of the continent.
When the thaw came, it was rapid. And as the summers warmed and lengthened, grass grew, herds of grazing animals followed it northwards and human hunters came closely and quickly behind. New analyses of carbon-dated remains in Britain and updated readings of the evidence from Greenland ice cores confirm that climate change took place over decades rather than centuries and that within the span of the memories of one or two generations pioneers left the Refuges and moved very rapidly into northern France and southern England. This was no slow exodus and the migrating herds probably set a brisk pace, pulling a dramatic repopulation behind them. As the ice and tundra retreated, bands of hunters advanced.
At Creswell Crags in Derbyshire, engravings on the walls of the limestone caves have been recognised and they show a clear link to Lascaux and the other famous sites on either side of the Pyrenees. High up on the roof of Church Hole, the outline of a bison has been made out and also a large stag. There are thought to be faint traces of twenty or thirty figures at the Creswell caves but perhaps the most intriguing is that of an ibex. Believed to be extinct in Britain after the end of the last Ice Age, this species of wild goat was still browsing the forests of the Ardennes on the Franco-Belgian frontier. It may be that the engraver at Creswell Crags had seen an ibex and was working from memory.