8.

Synthetic Biology

Kind of Like Frankenstein, Except the Monster Spends the Whole Book Dutifully Making Medicine and Industrial Inputs

We humans have been tinkering with biology for a long time. In fact, it’s kind of our thing.

We’ve been genetically altering biology, including the foods we eat, for at least 10,000 years. If you look at our primate cousins, their food tends to be seedy and high in fiber whereas our favorite foods are things like cake, beer, and beer cake*—no-fuss calorie conveyances.

We’ve gotten pretty damn good at altering biology. One time, we took a single species called Brassica oleracea and turned it into every vegetable you hated as a kid—brussels sprouts, cauliflower, broccoli, cabbage, kale, kohlrabi, collard greens. YES. All one species, slowly modified over generations into a thousand okay-tasting forms, each more cheese-requiring than the last.

We do this to animals too. Remember when we took the noble wolf—spirit of the forest and tundra—and converted it into a shivering, bug-eyed rat, dependent on the nearest blond socialite for diet kibble and a pink sweater? There is no greater expression of man’s dominion over nature.

All these changes occurred because humans started controlling the breeding of the life around them to have more qualities we like and fewer qualities we dislike. When they did this, they were unknowingly altering these species’ DNA. But our ancestors were altering DNA incredibly slowly, making small changes over many generations, and tinkering with traits that already existed.

Once we understood DNA better, we began trying to manipulate it. For example, there’s atomic gardening. The basic idea is that you get a radioactive substance, then grow your garden in a circle around it. Now you’re mutating all the surrounding plants at an increased rate, increasing the chance that you’ll find something really cool. To be clear, irradiating plants does not result in radioactive descendants. The radiation is just a convenient method to modify a plant’s genes, perhaps causing it to transmit those mutant genes to its offspring.

This may sound bizarre, but the (mildly) euphemized field of “mutation breeding” has created a lot of your favorite foods, like modern “Ruby Red” grapefruit and “Golden Promise” barley (which you’ve probably consumed if you’ve had a few Irish beers or whiskeys).

But this method is still quite blunt. You change a bunch of DNA and hope that, by dumb luck, there’s a noticeable useful mutation. But what if we could take an entirely new approach—instead of selecting good traits or making random changes to an organism’s genetic code, what if we could precisely alter genes, knowing exactly what the result would be? Sure, we could make a better grapefruit, but we could also take life beyond its current boundaries. We could convince bacteria to be little factories for medical chemicals. We could get microbes to take readings in areas that are hard for us to probe. We might even be able to alter human DNA, perhaps even in currently living humans.

We are going beyond the realm of natural biology, into what is called synthetic biology.

To understand how all this might happen, you need to know a little about DNA. Let’s do a quick rundown.

DNA

In all multicellular organisms (like mushrooms and humans), cells have a distinct inner portion called a nucleus. Inside the nucleus are really long molecules called DNA. You can think of DNA as an especially lengthy rope ladder that twists around and around in a corkscrew shape. This is the famous “double helix.”

The “rungs” of the ladder are made of two small molecules (one from each side) that fit into each other, hand in glove. Well, maybe we should say hand in glove or foot in shoe, since there are two ways these pairings happen. These small molecules are called bases, and they come in four types, abbreviated T, A, C, and G. Base T always pairs with A (hand in glove), and C always pairs with G (foot in shoe).

The result is that if you pulled apart this spiral ladder, yanking the hands and feet out of the gloves and shoes, you would see a long string of bases on each side. If you read them in order from beginning to end, it’d go something like “AAGCTAACTACACGTTACTG” only much, much longer. Like, one hundred and fifty million times longer in humans. These letters encode most of the information your body needs to do all the stuff you do.

So what the hell does that mean? Most of the stuff going on in your body is done by proteins. People generally think of proteins as the stuff you eat when you take a bite of chicken, but the word “protein” refers to an enormous category of molecules that function as the little machines that do pretty much all the tasks in your body. DNA is, so to speak, the library for how to make proteins.*

Now visualize the DNA ladder opening up, with each rung splitting down the middle, so that it’s a long string of T, A, G, and C bases. On this newly open surface forms a new molecule called RNA. RNA is a sort of mirror molecule to the DNA surface it forms on. So if the relevant DNA segment says “AGCT,” the RNA will form “TCGA.”* Or, to continue our metaphor, hand becomes glove, shoe becomes foot, and vice versa.

This new piece of RNA (called messenger RNA) is the carrier of genetic information. It leaves the nucleus and heads out into the rest of the cell. There it meets with a structure called a ribosome, which “reads” the RNA’s code in three-letter chunks, like “AAA” or “GCT” or “CAT.” In the ribosome, these three-letter “words” each become a kind of sticky spot for a particular amino acid. Amino acids are the molecules that cells use to build their protein machines.

Another type of RNA (transfer RNA) brings amino acids over to the ribosome, attaching them to the appropriate sticky spots. Each amino acid is then chemical bonded to the amino acid next to it, forming a long chain. When you assemble these amino acids in a certain order, they fold up into the complex shapes that allow proteins to move around, kick-start chemical reactions, and do all sorts of other tricks needed so that you can continue to do things like eat chips or yell at the news.

Okay, so that’s a little complicated. Let’s use an analogy.

Think of your DNA as the library of information for how to make machines. In this analogy, if you opened the book of DNA at a random place it might say something like “TNOIJ, EVLAV, POTS, SNEL, EBUT, SNEL, EBUT, TRATS, EVLAV, GNIR, SNEL . . .” and so on for many thousands of pages.

That seems like gibberish. But make a mirrored copy using Silly Putty,* and you get “LENS, RING, VALVE, START, TUBE, LENS, TUBE, LENS, STOP, VALVE, JOINT.” It’s still more or less gibberish, but it appears to have some meaning.

Now, observe that there’s a sensible internal snippet: “START, TUBE, LENS, TUBE, LENS, STOP.” When you assemble those things in the prescribed order, you get a telescope. So to speak, that’s the code for a telescope.

But telescopes are boring. Let’s suppose you’re trying to make something cool. For instance, one of Zach’s recent projects was the creation of the world’s first single-use monocle. Kelly thinks the project was stupid, but she is wrong.*

Somewhere in the DNA library, there’s a monocle section that when mirror-copied reads “START, RING, LENS, CHAIN, WRAPPER, STOP.” A Silly Putty copy is made and is brought outside the library.

Why would you come outside the library before making the monocle? Lots of reasons, but a big one is that you don’t want a machine shop inside your library. If you damage the Silly Putty copy of the “how to make a single-use monocle” section, you can still go back to the DNA library and press the Silly Putty in again. And if you want to make lots of single-use monocles at once, you’ll want to make a lot of Silly Putty copies and send them off to lots of different factories. If you damage the original book, making new machines becomes impossible. You might make incorrect copies that just don’t work. In the worst case, you might make machines that “work,” but do something very bad. Something like “START, RING, GASOLINE, LENS, CHAIN, FIRE, STOP.”

In any case, once the Silly Putty copy is out of the library, it goes to assembly, aka the ribosome. The assembly people take each word on the Silly Putty and attach glue to it. Then, the parts delivery boy (transfer RNA) brings over the parts and sticks each part on its reference word. Once all the parts are attached properly, the Silly Putty can be discarded or used to make more machines. If nothing goes wrong, the result is a finished single-use monocle, or (if many Silly Putty copies were made) an entire fleet of single-use monocles.

Just so, DNA opens up, RNA copies are made, and those copies leave the nucleus to go to ribosomes where proteins are assembled.

That’s a rough-and-ready sense of how DNA does its business, but the actual process can be much more complex, involving things like feedback loops and combining separate chunks of code to make a single machine.

“But wait!” you say. “When people talk about DNA, they always mention genes.” Where does that fit in? Well, it turns out a “gene” is conceptually a bit hard for scientists to pin down. Or at least it’s hard to define perfectly. This isn’t necessarily a big deal. Like, you know how you complain about the economy? Yeah. Now, define it.

One way to think about a gene is that it’s a chunk of DNA that appears to do something particular, whether we know what that particular thing is or not. A simple example would be the gene for blood type. Everyone has a section of DNA that, through the above process, determines what blood type they have. Of course, different people have different blood types, but this is just a reflection of the fact that their blood type genes have different code. Type B people and type A people both have a “blood type gene,” but the particular codes in that gene vary a bit.

That said, for most features you might identify on an organism, there isn’t a single gene. In fact, single-gene (or “monogenic”) traits are pretty rare.* Even something as simple as hair color or eye color is the product of lots of different genes.

Why should this be? Well, remember, this whole system wasn’t designed by anyone. It was the product of billions of years of evolution. Perhaps if humans had built it, each trait would be produced by one particular chunk of DNA, in the same way that each part of a computer is a separate module. But we’re stuck with evolutionary history.

So, for example, you might be able to find a gene called “GENIUS” that makes its human host 15% more likely to enjoy the classy convenience of a single-use monocle. That doesn’t guarantee this rare, valuable, and utterly civilized trait will be present in the person—it simply makes it more likely. In conjunction with other genes, GENIUS may increase the likelihood of single-use-monocle-having behavior to near 100%, but if the other genes counteract GENIUS, the unfortunate individual may be bereft of a sense of proper ocular apparatus. Or it may be more complicated—if you have gene A and gene B, but not C, you get one effect, whereas if you have A and C but not B and not D, you get another.

In general, a given gene often only tells a small part of the story.

For our purposes, the important thing to realize is that biology, at the most basic level, is a bit like a messy attic. If you move one thing here, it might cause a collapse over there. This means that if you want to breed for, say, cattle with gigantic horns, the easiest way has long been to just find a bull with big horns and a cow whose dad had big horns, give them a little mood music, and let nature take its course.*

This method works well enough, especially if you’re not the one with the job of . . . let’s call it concierge. But for the would-be mad scientist, the complexity of DNA (not to mention its tininess) has imposed limits on how fast and how much we can change biology. Humans haven’t been around very long. Very few species have been altered to specifically make things we like. We managed to control the yeast that converts sugar into booze, but why not a yeast that converts sugar into, say, jet fuel? They’re both chemicals, right? The DNA just has a chunk that says to make a certain chemical—can’t we change that chunk of code to something else?

This is the promise of synthetic biology. If you can create new pieces of DNA and insert them where you like into an organism, you can create biology that never would have been. Molecular machines that might turn cancer cells into normal cells. Pest organisms that help kill off their own kind. Or even just general purpose organisms awaiting our instructions. It’s life, made to order.

Where Are We Now?

Synthetic biology as we currently know it began in the 1970s. The early methods were complex and cumbersome. Still, a lot of what we take for granted about modern life comes from this era. Human-type insulin (which is probably* the kind you want) was only possible to manufacture en masse due to genetically modified Escherichia coli (also known as E. coli) bacteria and genetically modified yeast. Before that, we used animal insulin, derived from the pancreases of cows and pigs. Animal insulin required the slaughter of lots of animals to get enough insulin, and some people became allergic to the slightly different insulin molecule produced by cows and pigs.

Convincing E. coli to make human-style insulin turned out to be a relatively simple process, and it was solved in the late ’70s. Other drugs have proven to be trickier.

Fighting Disease

Human beings have managed to wipe out, or at least control, a number of diseases. Others, like malaria, have proven remarkably stubborn. The World Health Organization estimates that in 2015 there were 214 million cases of malaria, resulting in 438,000 deaths. This is actually a big improvement over twenty years ago, but there’s a long way to go. One particularly good treatment is a chemical called artemisinin.

Artemisinin is a compound extracted from Chinese sweet wormwood plants. Artemisinin-based drugs are some of the best treatments we have against malaria, but as every Chinese sweet wormwood enthusiast knows, growing enough of the plant is expensive and time consuming. This is especially bad for malaria because most sufferers live in economically impoverished sub-Saharan Africa.

The availability of Chinese sweet wormwood has varied dramatically over time, creating wild price fluctuations. For instance, the price was about $135 per pound in 2003, $495 in 2005, about $90 in 2007, and about $405 in 2011. When the prices drop, farmers stop growing the plants. This creates the shortage, which increases the price again. And you really don’t ever want to have a shortage of antimalaria drugs. Part of why we can’t get off this cycle is that the plants take time to grow. Finding a quick way to reliably supply artemisinin should lower the average price, or at least keep the price and drug supply more stable.

Drs. Chris Paddon of Amyris, Inc., and Jay Keasling at University of California, Berkeley, wanted to design a simple organism to create this medicine, so they turned to man’s best friend: Saccharomyces cerevisiae, aka brewer’s yeast. The little fungus that turns sugar into booze.*

The challenge is that you can’t just make artemisinin. If you think “artemisinin” is hard to pronounce, consider its chemical name: (3R,5aS,6R,8aS,9R,12S,12aR)-Octahydro-3,6,9-trimethyl-3,12-epoxy-12H-pyrano[4,3-j]-1,2-benzodioxepin-10(3H)-one.

In order to get some of this stuff, you have to generate a number of different chemicals that react with each other in the right sequence. Over the course of about a decade, their group worked through all the different chemical steps, altering the yeast’s DNA so that it would generate the appropriate chemicals to do the appropriate reactions in the appropriate order. Only in the last few years have they finally engineered a modified beer yeast that spits out artemisinic acid, which is easy to convert to artemisinin.

It works well, but the drug is having difficulty competing in the market. The new technology happened to come on the market just as artemisinin was at a particularly low price, so the old method is currently undercutting the fancy modified yeast. We’re not entirely sure who the underdog is here, but it’s a good lesson in how technological change is as much about market reality as scientific cleverness.

In any case, malaria is already developing resistance to artemisinin-based drugs in some regions. Thanks a lot, evolution. So what if we could use synthetic biology to stop people from getting malaria in the first place?

The mosquitoes that carry malaria and transmit it to humans often become resistant to pesticides. Mosquitoes reproduce quickly, which means every generation has a lot of chances to produce mutants who can defeat humanity’s best weapons. Here’s one way we could win the arms race:

Female mosquitoes often only mate once. What if we could trick them into mating with a sterile male? This should mean fewer cute little baby mosquitoes,* which means less malaria transmission. An early strategy to make sterile male mosquitoes was to expose them to radiation. This did indeed sterilize the males, but well . . . it turns out that when you expose a guy to a huge dose of radiation, it may increase his chances of sleeping alone.

Later, it became possible to make direct genetic changes to mosquitoes, and scientists made a little addition to the mosquito genetic code. Mosquitoes with this added gene require the antibiotic called tetracycline, or they die. You give them tetracycline when they’re born, and then they go off and mate. They then produce children who will die without tetracycline. Those children don’t have a scientist standing by to deliver the antibiotic christening, so they die off before they can make another mosquito generation.

Okay, so this works in the short term, but it’s very expensive. When you introduce a gene that results in all of its descendants dying, that gene doesn’t last too long in a population. The mosquitoes bounce back in a few generations. This means that if you want to keep mosquito populations down, you have to keep introducing carefully gene-manipulated mosquitoes over and over.

Unless you have a gene drive. Here’s how it works:

When a mommy and daddy love each other very much, they turn out the lights and combine their DNA. If everything goes terribly wrong, they have a baby. Now, suppose there’s a single gene for color of nose hair.* Mommy gives you a gene for black nose hair while daddy gives you a gene for vibrant orange nose hair. Later, you will produce offspring whose nose hair color is influenced by the genes you got from Mom and Dad.

But now imagine Dad’s orange-nose-hair gene was not an ordinary gene. In addition to coding for orange nose hair, it also destroys the other partner’s nose-hair gene. When this happens, the DNA fixes the destroyed gene by copying the orange-nose-hair gene. So now you have two of Daddy’s orange-nose-hair genes and none of Mommy’s black-nose-hair genes.

What happens? Well, you definitely end up with orange nose hair. But then . . . something more sinister and orange takes place. All of your siblings also have orange nose hair. And so do all of your children. And their children! The gene “drives” its way through the entire population. This is true even if vibrant orange nose hair (inexplicably) makes you less sexy. You might have fewer kids, you ginger-nosed freak, but all of them will have the selfish gene.

So gene drives mean that you can impose synthetic biology on an entire wild population. Dr. George Church of Harvard and others were able to put multiple gene drives for malaria resistance into mosquitoes. That way, instead of having to release modified mosquitoes every season, you could potentially have a one-time release of mosquitoes with multiple malaria-resistance gene drives. Even if malaria resistance makes them less attractive mates, the gene should spread through the population, growing exponentially as it goes.

According to Dr. Church, the goal is complete eradication of malaria. But releasing an organism with engineered DNA into the wild in order to kill off an entire species (even if the species was a parasite) was bound to raise some scientific hackles. A panel at the U.S. National Academy of Sciences thinks the technique is promising enough that they gave the go-ahead, but they want to see a lot more research in this area before thinking about releasing these mosquitoes into the wild.

Medical Diagnostics and Treatment

When your dog runs into your house, it can’t tell you that it’s been rolling around in mud and eating squirrels. Somehow, you just know. The body of the dog holds a record of the day’s journey in its smell and appearance. Some scientists wondered if the same could be true for bacteria. This would be useful, because you could send the bacteria on a magical journey through your digestive tract. They could put together a little scrapbook of the trip, then give it to your medical provider when they . . . emerge. It’s not the most delightful image, but it might be preferable to the current method if sticking a camera in there.

Dr. Pamela Silver and her lab at Harvard Medical School had a thought: Could you create a synthetic mechanism that could capture information into a bacterium’s DNA and recover that information later? Basically, can you get bacteria to “observe” their environment and then change in some way that tells you what they saw? The answer is yes. Duh.

Here’s the idea: Two cells of the same type, with the same starting DNA, can have variations that they acquire from their environment. For example, there may be molecules attached to their DNA that change how it codes for things, or there may be some kind of chemical feedback loop that results in higher or lower expression of some particular gene. And, in some cases, a cell may pass its acquired alterations to its offspring.

These changes, if they persist in a form we can decipher, could tell us about what the bacterial cell “saw” on its trip. The problem is that bacteria aren’t naturally designed for this purpose. It’s sort of like the dog from earlier—if it ran to the neighbor’s house, suddenly developed intelligence, killed the neighbor for his money, took up online poker, lost it all on a bluff gone wrong, went mad and lost its intelligence, then ran through some mud and came home, well . . . all you’ll see is that there’s mud on the carpet.

With a dog, you can just strap a camera on. With bacteria, you can’t. It’s too small, and the sun doesn’t shine where it’s going anyway.

In DNA, you can find a sort of chemical loop* in which the DNA creates a molecule, and the molecule tells the DNA to do it again. It’d be sort of like if you made a sign that said: “WHEN YOU READ THIS SIGN, MAKE A COPY OF IT, THEN READ IT.” Once the loop triggers, you keep making signs forever.

In principle, such a chemical loop should be able to function as memory. To continue the sign analogy, suppose you had a mental program that went something like this: “When your pants fall down, make a sign that says ‘WHEN YOU READ THIS SIGN, MAKE A COPY OF IT, THEN READ IT.’” If we later saw you making endless signs, we could conclude that your pants had likely fallen down without ever having to make the necessary observations.

DNA works in a similar way: Once the loop is turned on, it’ll just keep going. And the active loop will pass down through generations of cell lines, at least for long enough that you can recover useful information from it.

Dr. Silver’s lab has already done this. They’ve created synthetic DNA loops that are inserted into bacterial DNA. When the bacteria experience certain conditions, their loops activate. Because you are creating the loops synthetically, you get to decide what chemicals they’re creating. This means you can decide on a chemical that’s easily detectable by, for example, shining when exposed to certain types of light.

To give you a sense of why this might be useful: tumor cells often experience repeated oxygen deprivation because they grow so quickly that they don’t get a sufficient blood supply. It turns out that repeated oxygen deprivation produces a detectable chemical signal in tumor cells. So Dr. Silver’s idea is that you can put programmable memory cells into someone’s body, then check them later to see if they’ve detected areas of low oxygen. If they did, it’s possible they found solid tumors.

This method is still in an early phase, but the clinical applications could be incredible. Once you have this general method for creating cell-sized programmable sensors, the door is open for researchers to program the cells to detect all sorts of things.

When you pair this with other work Dr. Silver has done, things get really interesting. For instance, Dr. Silver and her colleagues published a paper in 2016 with the title “A Tunable Protein Piston That Breaks Membranes to Release Encapsulated Cargo.” That is, you can program bacteria not just to listen for problems, but to deliver treatment.

This method could have applications from cancer drug delivery to treating irritable bowel syndrome. It is also targeted. Right now when you have inflammation of the gut, you take aspirin orally, releasing the chemical into your entire body, most of which is not inflamed. In principle, you could create a bacteria species that holds on to aspirin until it detects the chemical signature for inflammation. If this method could be generalized, as Dr. Silver’s work suggests, perhaps all sorts of medicines could be delivered right to the relevant target, maximizing effectiveness and minimizing side effects.

Organs from Nonhumans

Scaling up a bit, it may be possible to synthetically modify large animals to make things we like. In our chapter on bioprinting (stay tuned) we talk about the challenges of quickly building whole organs from scratch. But animal bodies already know how to create organs. So next time you see a pig, maybe you should visualize a 3D printer for kidneys instead of a plate of bacon.

It turns out that pigs are particularly good for this sort of thing because their organs are similar in size to ours. Transferring organs between species—which has the ominous name xenotransplantation—doesn’t have an excellent history of, you know, working.* Most of the research has focused on transferring between nonhuman animals, like from pigs to baboons. We still haven’t figured out how to keep the immune system of the recipient animal from killing the donor organ, but some progress is being made. One thing that would make this all much easier would be if the organs from the donor animal “looked” to the immune system more like organs from the recipient animal.

So just like we modified yeast to create malaria drugs, we should be able to “humanize” pig organs. Part of how your body knows you just got a pig heart instead of a human heart is that the pig heart contains and creates a lot of molecules that are similar to the human version, but different enough to be recognized as foreign. For example, there’s that pig version of insulin we mentioned earlier. By altering pig genetics, we should be able to make pigs whose organs are molecularly very similar to human organs.

Scientists recently announced that a pig heart had been kept alive in a baboon for over two years,* using this method along with drugs to reduce the immune response. Some readers may feel squeamish about putting pig organs in humans, but we suspect they wouldn’t feel that way if they urgently needed a liver.

A more serious concern is that we’ll accidentally pick up brand new diseases from pigs. Dr. Luhan Yang and her lab at eGenesis are working to fix this. The problem is that pigs contain “porcine endogenous retroviruses,” which are (yes, really) referred to as PERVs. PERVs are found in pig DNA, and they release particles that infect humans. Humans don’t want PERVs inside them,* so they employed a new technique called CRISPR-Cas9 (discussed shortly)—to cut out the pig PERVs. This doesn’t eliminate all risk of a disease-jumping species, but it eliminates one of the scarier possibilities.

Fuels

Cells are probably the best chemists there are.

• Dr. Pamela Silver

In 2009, Dr. Dan Nocera of Harvard discovered a relatively cheap catalyst that could be placed in water. When it got a little energy, it would split water (H2O) into just the H and the O.* This catalyst was potentially a big deal because when you split water into hydrogen and oxygen, you have an excellent form of stored energy. When you bring these elements together and apply some energy, you get a big explosion when they combine back into water. Hydrogen fuel cells essentially do this trick but without the explosion part.

So the idea is that you can make cheap, clean fuel cells by using heat to split water and then bringing the split parts back together when you need energy. This is really just a simplified and controlled version of how plants make energy. According to Dr. Silver, “The process of photosynthesis, which is one of the most amazing things nature does, is to harvest sunlight and use that sunlight for energy to make stuff. That’s the basis of life on earth. . . . One of the key reactions in photosynthesis is called the water-splitting reaction.”

But for Dr. Nocera, things didn’t work out as planned. The device worked well enough, but hydrogen fuel cells never caught on as a way to store energy. Making things worse for him, but great for everyone else, regular old solar power cells got a whole lot cheaper, making his product less exciting. Dr. Nocera’s idea was shelved for a time. But harnessing water splitting has a lot of potential. You’ve got this ultracheap way to split water, but the way you get energy out of it is cumbersome. Then, Dr. Silver had an idea.

Her lab introduced a genetically modified bacteria that could take the hydrogen and oxygen, combine it with carbon dioxide, and convert it into isopropanol. Isopropanol is a fuel that can be separated from water. The result is a system in which the inputs are a metal catalyst, water, bacteria, and carbon dioxide, and the output is a chemical you can use to run your stove.

This is kind of wild if you think about it. You put the right material and biology in water, you let it get some light and heat, and then you start seeing fuel forming in the container. And because you’re mimicking life and extracting CO2 from air, your fuel is much more environmentally friendly.

Dr. Silver told us, “Our contribution was . . . to make that process as efficient as probably the best photosynthesizer, which is algae. Actually, we beat algae now. In the original paper I think we said we were beating plants; we’ve now beat algae.”

They are currently seeing if the process can be made cheap and scaled up.

Another group is working on a way to go from switchgrass to jet fuel. If you’ve never heard of it, switchgrass is a tall green plant that’s all over North America. It’s a hardy grass that grows quickly and densely, even in bad soil.

In case you don’t remember high school botany, cellulose is one of the main structural components in plants. Cellulose is a very long chain of sugar molecules. So perhaps you’re now thinking, “Why don’t trees taste good when I lick them? I keep licking all sorts of plants but they’re almost never sweet!”

First, stop it. Second, cellulose chains are pretty hard to break down into tasty sugar molecules. Unless you have specially developed enzymes to break down cellulose sugar, you can’t digest it. This is why cows have complex digestive systems—they’re doing God’s work of converting stubbornly hard-to-digest grass into beef.

But doing your business inside a cow is never a good way to go. So, Dr. Aindrila Mukhopadhyay’s group at the Joint BioEnergy Institute created bacteria that can convert renewable plant resources (like switchgrass) into d-limonene, a precursor to jet fuel. Her group’s modified bacteria can take pretreated switchgrass, break the cellulose into little sugars, then turn those sugars into d-limonene.

They are hoping to get the process to the point where the bacteria spit out straight-up jet fuel, but getting to d-limonene in one pot already cuts out a lot of steps you normally need to make bio-jet fuel. And, because the carbon source is the airborne CO2 that the switchgrass converted into cellulose, in principle, you could get your jet fuel without adding much CO2 to the atmosphere.

Biofuels like this have enormous potential to reduce our reliance on petroleum-based products, but so far cost has been a serious issue. Petroleum prices continue to be quite low, so it may be some time before we’re using weeds to fly to Amsterdam.

Environmental Monitoring

Dr. Silver was able to give cells the ability to remember and report back on their experience inside the body. Could we do the same in open environments?

Dr. Joff Silberg and Dr. Carrie Masiello are a husband-and-wife team of professors at Rice University. He is a synthetic biologist. She is a geologist. But somehow they managed to move past that and find love.

Dr. Masiello studies biochar, which is made when plant matter gets baked at a high temperature in the absence of oxygen. The creation of biochar sequesters carbon that would otherwise end up back in the atmosphere, and it is frequently added to soil to increase plant growth. We don’t know precisely why it helps plant growth, but it may be that it alters the composition of microbes in the soil. Dr. Masiello wanted bacteria that could report back to her on what conditions were like for microbes living in soil with and without biochar. She asked Dr. Silberg to make her a synthetic microbe for Valentine’s Day. Yes, really.

Dr. Silberg created bacteria that release gases that aren’t commonly found in soil. So by putting the synthetic microbes in soil, then monitoring the gas release, we can “eavesdrop” on microbe behavior instead of grinding them up for analysis.

Most of us aren’t quite so romantic about gassy soil microbes, but this technique could be extended to environmental contamination. Groups have already modified bacteria to glow in the presence of arsenic and water. The more arsenic, the more glowing. It’s like a nightlight that runs on poison.

Potentially, a technique like this could be used to find and monitor toxic environments. Thanks to advanced synthetic biology, you can already write bacterial programs that are more complex than just “Glow if you detect toxins.”

A major hurdle for this field is that supertoxic environments are bad for bacteria too. So when you don’t see glowing, you think it’s because no arsenic was detected, but actually what happened is all of your bacteria are dead. Scientists are working to solve this problem. One idea is to use particularly hardy organisms that are already used to toxic environments.* Another idea is to create more complex signaling mechanisms, along the lines of “Red light means bad, green light means good, no light at all means MOTHER OF GOD RUN FOR YOUR LIFE.”

If people decide they’re okay with synthetic bacteria running around in the world, you could do continuous monitoring of conditions just about anywhere. If the soil in a particular area started glowing green, you would know there was arsenic. Blue could mean toxic levels of mercury. Yellow could mean lead. Basically, if you come upon a mysterious cove where nature enrobes herself in prismatic illumination, don’t drink the water.

Generalizing Synthetic Biology

All these things are neat, but they’re also really hard. There have been ways to modify genetics directly since the 1970s, but the methods are difficult, expensive, and time consuming. Or, at least, that was the case. In just the last few years, a new method has come on the scene that promises to change everything.

A group led by Dr. Jennifer Doudna from the University of California, Berkeley (and the Howard Hughes Medical Institute), and Dr. Emmanuelle Charpentier of the Max Planck Institute for Infection Biology discovered a way to make molecular scissors, thanks to a quirk in the way bacterial immune systems work. The system in bacteria is called CRISPR-Cas9. If you didn’t guess, that first acronym is short for “clustered regularly interspaced short palindromic repeats.” Just pronounce it “crisper,” like the drawer in your fridge.

A naturally occurring bacterium doesn’t have memory storage in the same sense that you do. It can’t see, hear, or think. But bacteria are able to fight off viruses they’ve encountered before. Somehow, they “remember” viruses and attack them.

Here’s how it works: When a virus infects a bacterium, it injects bits of genetic material through the bacterium’s cell wall. These bits of genetic material try to take over the machinery of the cell in order to make more virus particles. But the bacterium has a protein called Cas, which can fight off the virus. When Cas is successful, it takes part of the defeated virus’s genetic material and adds it to a special section of the bacterial cell’s DNA. This gives the bacterium a way to remember the virus.

Later, when that bacterium bumps into the same virus, it “recognizes” it using the stored code and then cuts the virus protein in the recognized place. The bacteria isn’t cutting in the recognized place out of a sense of poetic justice—it’s just that when someone attacks, cutting them in pieces is a pretty good defense. But the result is a handy tool for humans—Cas always snips at a certain genetic location. Targeted molecular scissors.

And here’s the cute part: In a healthy cell, when its DNA gets snipped, it attempts to repair itself by joining the two ends back together. Before the repair happens, you can slip in new molecules that fit in the gap. The DNA heals itself up, and BAM! You’ve just selectively introduced new code into a cell’s DNA at a spot of your choosing. And you did it into a living cell.

The lab groups of Dr. Feng Zhang at MIT and Dr. George Church worked out methods to use CRISPR-Cas9 on mice and humans. So, as of 2013 or so, you can run around in cells from all sorts of organisms, snipping DNA out and sticking DNA in willy-nilly. What shall we do? Play God? Besiege the ancient vale of Nature with the iron cannons of Science?! Don’t mind if we do!

Of course, as the Garden of Eden story tells us, when you play God with some preexisting organisms, they don’t always behave right. Until we can make whole organisms from scratch, we’ve got to twiddle with DNA inside creatures that nature made. But we don’t have to play nice with nature.

The Simplest Organism

Dr. J. Craig Venter famously raced Dr. Francis Collins’s National Institutes of Health to decipher the human genome. Now he’s on to bigger things. Just to give you a flavor of Dr. Venter, he once responded to the writing prompt “What *Should* We Be Worried About” with an article that began, “As a scientist, an optimist, an atheist and an alpha male I don’t worry.”

See, this is exactly the kind of person you want if you need someone to play God. He works at a place that happens to be named the J. Craig Venter Institute. Aside from being fearlessly alpha all day every day to the max, Dr. Venter’s team is working on creating the simplest organism possible.

Their idea is that if you have an extremely simple organism, it should be relatively easy to tell what’ll happen when you alter its DNA. You’ll have a sort of blank canvas for new genes, so scientists can figure out the effect of their changes much more quickly.

They began with an organism called Mycoplasma genitalium, so named because it is found in human genital and urinary tracts. In addition to being conveniently located, this organism has an extremely short genome. They started snipping out and discarding more and more genes to see what was essential to survival. Sometimes losing a gene killed the organism, but sometimes it didn’t. After a lot of work, and after (sadly) switching to a related species with a less funny name,* they arrived at an organism with only 473 genes.* Humans, by comparison, have about 20,000 genes. Venter’s group dubbed the new organism Mycoplasma laboratorium.

Dr. Venter is an atheist, but just in case there is a God to piss off, he named the latest version of this organism Syn 3.0. Investors are already signing up to see what Syn can do for them.

Biohackers and Standard Parts

For those of us who aren’t quite as excited by a secretive genius creating a proprietary form of life, there is also a grassroots approach to synthetic biology.

A competition called iGEM (International Genetically Engineered Machine) happens annually, and pits students (including high school students!) against one another to see who can create the most exciting genetically engineered organism. In 2015, teams created (among other projects) a biosensor that worked with your iPhone and could detect heavy-metal contamination and date-rape drugs, an organism that secretes chemicals to adjust the freezing point of the water it’s in, a cheap and fast test to determine if a cancer has metastasized, and a biosensor that quantifies the purity of heroin.

The teams also put any “parts” that they create in a “Registry of Standard Biology Parts,” which is freely available and can be added to by people who did not participate in iGEM as well. In other words—open-source biology Legos. You can order these parts and do synthetic biology research if you have the equipment, which is becoming increasingly available at “biohacker” spaces. So your neighbor could be the next person to solve our energy crisis, or cure a disease, or write “KICK ME” in your skin with bioluminescent chemicals. If you lived near MIT this was probably already true, but soon it may be an experience for everyone to enjoy.

Concerns

Tinkering with the language of life. What could go wrong? An early mantra of the Internet was “information wants to be free.” That sounds nice, but it’s a problem if the information is how to make smallpox from scratch.

Ultimately, synthetic biology should give humans the power to have organisms made to order. As that technology becomes cheap, the ability to bring back diseases for which we no longer vaccinate might become something you could do on your desktop.

Consider smallpox: After 1980, we stopped vaccinating because it was mostly gone.* This disease may have killed half a billion people in the twentieth century, and most living people have no immunity to it. If synthetic biology became easy, what would stop a rogue biologist (or just an angry geek) from bringing it back?

Scarier still is the possibility that a disease like smallpox could be modified to make it spread more rapidly and be more lethal. A biohacker could in principle design the disease to elude all known therapies. We also know that some diseases may affect human behavior. For instance, flu vaccines apparently make human beings more social, perhaps to the benefit of the disease. A disease designer could potentially make society-level behavioral alterations via a subtle pathogen.

At the moment, the companies that make made-to-order DNA keep an eye on the orders submitted by their customers. But as DNA synthesizers get cheaper and cheaper, could this become the kind of thing you could do at home? The best hope may be that the power to create diseases will come along with the power to fight them. But prevention by some means is probably better than an arms race in which human beings are the battlefield. One other bit of cold comfort is that bioterrorism is rare, probably because it’s tough to control. Terrorism, by definition, serves the actor’s political goals, but very few people’s interests are served by creating a life form that might easily infect and kill their own people.

Ecologists worry that synthetic organisms might become invasive by accident. This could be scary if we’re using them to mass-produce industrial chemicals. Having a pot of bacteria that churns out jet fuel is fine, but what happens if the bacteria gets loose and starts doing its thing in a river? The hope is that these bacteria, which are designed to work under particular and unusual conditions, wouldn’t do well in the wild. But bacteria can exchange genes with each other, and they evolve rapidly. Scientists are working on ways to prevent synthetic bacteria from exchanging genes, but there’s no way to completely ensure safety.

And what about the organisms we’re creating that we specifically plan on releasing into the wild—the gene-drive mosquitoes from earlier? Dr. Silberg has some reservations about the pace at which we release synthetic organisms into the environment. “I want to see people doing molecular gene stuff interacting with ecologists a lot more to make sure that we fully understand the potential environmental impacts as we consider the potential benefits. Because there’s a whole field of ecology where people think about what wacky things people have done in Australia over the years, the catastrophes that have come from not really thinking about what this means from an ecosystem perspective.” For example, we introduced cane toads in Australia to control a native beetle that was a pest on sugarcane plants. The introduced toads reproduced like crazy and started spreading across the continent. These toads produce a toxin that kills their predators, and so as the toads spread they killed native predators (and some unfortunate pets).

This problem gets a little more personal when we consider introducing synthetic organisms into our own bodies. Even if they’re carefully engineered, there might be some risk of a mutation that makes them dangerous. But, as Dr. Silver notes, dangerous mutations are already a possibility with the nonsynthetic bacteria inhabiting your body.

In the next chapter we discuss using CRISPR-Cas9 to fix genetic disorders in human beings. Most of us are cool with the idea of using the techniques of synthetic biology to cure diseases in adults, but some scientists are also proposing using CRISPR-Cas9 to cure diseases in human embryos, making changes that would be passed on to subsequent generations.

There are some who argue that the benefits outweigh the risks. But where would we stop? If we’re able to modify human embryos, what’s to keep us from making designer babies? Adjusting hair, eyes, skin, perhaps even IQ, might be an option in another generation or two. And it won’t be an option for everyone. In a world of haves and have-nots, one group may be able to produce uniformly superhuman children while another group has to deal with genetic disorders that are easily fixable.

At the time of this writing, scientists in the UK are allowed to modify human embryos, while U.S. scientists are not. In China, CRISPR-Cas9 was used to modify human embryos, and the results were pretty abysmal. Lots of things went wrong, including unexpected mutations popping up. Remember, we don’t yet know what we’re doing here. Even if a designer human were successfully created, we don’t know how its genes would affect future generations.

How It Would Change the World

It’s the most amazing time. You no longer have the burden of really tedious experiments; you’re just limited by imagination.

• Dr. George Church

Synthetic biologists want to make their knowledge open and easily accessible. In less than a single lifetime, we’ve gone from wondering about the structure of DNA to reprogramming it with its own machinery. In the more distant future, this could have some wild ramifications. Like, storing memory in DNA.

How? Well, remember that all the memory in your computer is just an arrangement of 0s and 1s. DNA is just an arrangement of letters—A, C, T, G. In a certain sense, it’s like an ultracompact version of the strips of memory tape computers once used. By synthesizing DNA with the right code, you can store up to 10 billion gigabytes of data in a space smaller than a drop of water. That’s fifty million copies of The Lord of the Rings movies, or half a copy of Windows 10. And DNA is an extremely stable molecule, with a half-life of about five hundred years, meaning in about five hundred years half of the information will be degraded.

We don’t do this outside of the lab yet, because writing out custom strings of DNA is expensive. Right now, it’s about 10 cents or less per letter. For reference, the human genome has about three billion letters. Scientists hope that demand for DNA synthesis will drive down the price. Dr. Church proposed a follow-up to the Human Genome Project, in which we synthesize the complete human genome as a way to start driving these costs down.

In the future, we might take synthetic organisms to space. As you’re now well aware, getting stuff to space is expensive. If you had bacteria to manufacture products and recycle waste, you could make much better use of available resources. This becomes especially important if you want settlements on other planets and moons. Synthetic bacteria could be specially designed to work with any local environment to make whatever resources you need. And because those bacteria would be able to replicate, you’d only need to take a few of them with you.

So-called GMOs (genetically modified organisms) have gotten a somewhat bad reputation as “Frankenfoods” in the popular discourse. Our view is that if a Frankenfood can provide more calories and vitamins to poor communities, we should call it a win. But even if you want your tomatoes to be untouched by the hands of bioengineers, you might appreciate that GMOs can also give us greater access to medicines and clean fuel.

As we learn more, the line between synthetic biology and nanotechnology becomes meaningless. We are pursuing smaller and smaller machines, and biology just happens to have had an extra four billion years to learn how to manufacture them.

Recently, scientists created a new form of DNA. Regular DNA, as you now know, has four chemical letters—A, C, T, G. The new DNA has two new letters—X and Y. This is completely alien—it is something that would be mind-blowing if we’d found it on another planet. But instead, we’ve created it in the lab. And it’s not just neat—it comes with a lot of possibilities.

Normal DNA can make 20 amino acids—the building blocks of life’s molecular machines. This new DNA can make 172. The number of possible proteins it could make includes many that have never been made in nature.

This is the promise of synthetic biology—not just changes to life as we know it, but the creation of life as we might imagine it.

Nota Bene on De-extinction

Somewhere between two hundred and two thousand species are currently going extinct each year, and a lot of that is our fault. As an analogy, you can imagine humanity as a gigantic pair of jaws gobbling up everything beautiful and excreting the tawdry spectacle we call civilization. In fairness, civilization created nachos, so you know . . . trade-offs.

We could stop destroying habitats and introducing invasive species, of course, but so far our track record hasn’t been great.

Because ecosystems are complex, destroying one species—even one that appears to have a small effect on its community—can result in the extinction of others. This collateral extinction can cause further extinctions, and so on. But what if we could stop the ripple of destruction by bringing back recently lost species? Preserving these diverse environments intact is one of the goals of scientists who study how to resurrect extinct species. Yep. It’s about ecosystems. Certainly not about riding dinosaurs and eating mammoth-burgers.

Okay, so you want to bring back long-dead animals. It’s not as easy as it looked in Jurassic Park. In order to have a chance, you have to have the genome of the lost organism. Humans have only known that DNA carries heredity for a few generations, so it’s not really fair to expect cavemen to have preserved mammoth DNA in nice climate-controlled containers for us. But here and there, by accident, nature has preserved ancient DNA.

The longer DNA is exposed to the elements, the more it degrades. Right now, scientists think that after about a million years of degradation, DNA can’t be recovered. This fact precludes almost all of the most awesome animals. But it does leave a lot of possibilities: mastodons, dodos, saber-toothed cats, and maybe even near-human relatives, like full-blooded Neanderthals.

We talked to Dr. Beth Shapiro at the University of California, Santa Cruz, to find out how we could get a pet mammoth. You know, for ecosystems or whatever.

First, you locate as much of the mammoth genome as you can. This is not a small task. Even if a mammoth was well preserved in the Russian tundra and you get a good DNA sample, only a small percent of it likely belongs to the mammoth. The rest of the DNA belongs to the microbes that lived in the soil, the scientist who didn’t take enough care when moving the carcass, or the cavepeople who thought to themselves, “Screw you, future geneticists,” and spat on the dead mammoth during the Ice Age.

So you have to filter through your data to find the small quantity of DNA that actually belonged to the mammoth, and then do your best to figure out where in the mammoth genome those DNA sequences actually belong. With luck and patience, you can assemble a mammoth genome that is very close to what you would’ve found 20,000 years ago. But, you’re not going to be able to get the entire mammoth genome. Inevitably,* some pieces will be missing, and the pieces you do have will be so small and scattered that you’re going to need a cheat sheet to figure out how to put them back together.

Now you take the genome of the Asian elephant and compare it with what we have of the mammoth genome. Asian elephants are closely related to mammoths, so you can take a full Asian elephant genome and splice in mammoth genes wherever appropriate. These genomes probably differ by about 1%, but that’s still a lot of genome tinkering. Like, a lot more tinkering than we can easily do at the moment with our current techniques. Near-term attempts at mammoth de-extinctions may be more elephanty* than desired.

But now say you’ve got the mammoth DNA. Well, DNA doesn’t just spontaneously turn into a full-grown animal. If it did, there’d be a lot more teen fathers. You insert the mammoth DNA into an elephant egg and impregnate an Asian elephant mom with a woolly mammoth baby. This further compounds the elephantishness problem, because a modern elephant may have crucially different womb conditions, due to genetics, diet, hormones, and so on.

And, once born, the mammoth needs a modern elephant’s microbes. “So,” says Dr. Shapiro, “it’s born, it eats a little bit of elephant poo, because elephants do that to establish the community of microorganisms that live in the gut that can then be used to break down the food that elephants and mammoths eat. It will then have an elephant’s microbiome.” Welcome back to Earth, long-dead creature! Welcome back, sole representative of your kind! Now, eat some poop.

Voila, you’ve got a mammoth, albeit it with some elephanty features. If the goal was to 100% recreate the lost mammoths, you probably fell short. But if the goal was to create an animal that played an important role in an ecosystem before it was lost, well then, maybe an elephantlike mammoth is pretty good.

As Dr. Shapiro tells us, “An ecological replacement really can replace these missing ecological interactions that have disappeared because of extinction, in a way that revitalizes that ecosystem and saves living species from going extinct. This is what I see as the power of this approach. We don’t have cold-adapted elephants, but we could use synthetic biology to make them. In that way we could replace this missing component of this ecosystem and reestablish these rich grasslands that used to live in Siberia, creating habitats for things like saiga antelopes, and wild horses and bison.”

Let’s assume for a second that our technology will one day advance to the point where cloning a mammoth is possible. Where is this mammoth going to live? Mammoths used to live in Siberia, but will the Siberians welcome mammoths back with open arms? Perhaps not. Gray wolves were reintroduced to Yellowstone National Park in 1995, and the ranchers in that area haven’t exactly been thrilled. There have been lawsuits, and ranchers have gotten in trouble for shooting wolves to protect their cattle.

But it turns out there is already some habitat in Siberia just waiting for mammoths to return. Dr. Sergey Zimov has been waiting for them, and has put aside land on which he hopes mammoths will one day roam again. He also probably has tourism on his mind, as he has named the land Pleistocene Park.

Maybe at this point, you’re thinking, “So there’s no way to bring back dinosaurs?” We had an expert on the phone, so we asked her.

“Using a computer, we could reconstruct what the genome sequence of the ancestor of all living birds, avian dinosaurs, looked like, and that would in essence be a dinosaur. It wouldn’t be a T-Rex or a brachiosaur or a velociraptor because we don’t have any DNA from them, but it would have been something that lived contemporaneously with dinosaurs and was the ancestor of all living birds. We could use synthetic biology to gradually swap out modern bird (living dinosaur) genome pieces with this ancestral computationally inferred bird (dinosaur).”

Well, we didn’t spend our childhoods dreaming of riding a computationally inferred bird ancestor, but . . . close enough.