2
JOURNEY OF FEAR
DARWIN WOKE WITH a start. He pushed himself up and dropped back into the chair. A pool of drool lay on the pristine surface of the table, slowly spreading toward the scattered mail. He lifted the bottom of his t-shirt and wiped it away. The single can of Coke sat where he’d placed it on the coaster. He laid his trembling fingers on it, gently moving them down the smooth metal sides. One part of his mind was sure he was going insane. Another part told him he had just been hallucinating—that everything he remembered was a dream induced by the headache and pills.
His head throbbed like something inside had snapped and broken off, leaving behind a jagged, gaping wound. The pain had moved from behind his eye to the back of his skull, spreading around the sides and over the top.
At least the buzzing was gone.
The oversized clock on the wall said it was nine-thirty. What the hell? His chest tightened, and he couldn’t pull in a breath. Where had the time gone?
He picked up the scattered mail with shaking hands, taking another wipe at the drying drool. His dad would be pissed if there was any mess when he got home from another late day at work. He hated if anything was out of place. Darwin took a quick peek at the clock again, gently shaking his head in disbelief. Five hours gone! He straightened the mail back into the original pile left by the maids and grabbed a towel from the kitchen to give the table another wipe down.
He left the Coke can for last.
The can was warm, with not even a hint of sweat on the outside to show it had ever been cold. He fumbled as he lifted it off the table, and he could feel the liquid inside slosh around. He waited until it stopped.
What the hell had he expected, another episode? Maybe it was just a dream. He’d fallen asleep and imagined the whole thing. He would almost have believed it, except for the headache left from the incident outside this afternoon.
He used the warm Coke to wash down a couple more Advil before he poured the rest down the drain and tossed the can into the recycling bin. If the headache was still there in the morning, he’d go see his doctor. It had been years since he’d been there. Basically since he had left for university. He was pretty sure he was still a patient. Maybe he’d find a psychologist.
He’d have a talk with his dad as well. Now wasn’t a good time, though; there was too much going on at his work, and Darwin didn’t want to put any more stress on him.
Taking one more look around to make sure nothing was out of place, he went up the stairs to his bedroom and crawled into bed, hoping that by morning everything would be back to normal.
He wasn’t going to hold his breath.
Darwin opened his eyes to the darkness of a New Jersey morning before the sun had a chance to come up. The opening riffs of Jimi Hendrix’s “Purple Haze” filled the room just as his feet hit the floor. Five in the morning. He reached for his phone and turned off the alarm. He wasn’t even sure why he set it anymore. The crippling episodes had started last week, and along with them had come the ability to wake up whenever he wanted to, as though part of him was attuned to time itself. He shrugged. It seemed some good always came with the bad. At least his headache was gone, and with it the buzzing. A creak outside his room told him his dad was in the hallway. It was followed by a knock on the door.
“You coming to work with me today, or are you going to take your own car?” His dad’s voice came muffled through the closed door. Another knock. “Hey, bud. You awake?”
The internship at Quantum Labs had him working with his dad. They’d been working on the QPS, the Quantum Power Source project his dad was spearheading. The machine was a power generating system, able to generate clean power that had the potential to be limitless. A huge chunk of their funding had come from the military, including Darwin’s pay. Being an intern had let him get his fingers into almost every aspect of the project, though his main task had been number crunching and programming the monitoring systems for when they powered the thing up. He’d been there six months, and he figured the only person who knew more about the overall systems was his dad.
When he’d applied for the internship, he’d booked the last two weeks of the summer off. He had no friends to visit, that ship had sailed long ago, but he had wanted at least some time to relax before getting back to the grind of university. Because of it, he’d missed the preliminary evaluations of the QPS. The full test was happening today, and he wanted to be there. He wasn’t going to miss it after all the work he’d done.
There was another knock on the door, louder this time. “You still coming for today’s big test?”
“Yeah. Yeah, I’m up. I’ll go in with you if that’s okay.”
“No problem, but you better move it. I’m leaving in thirty minutes.”
“Yeah, I just need to shower.”
“Make it quick.” The floor creaked again as his dad walked away.
By the time Darwin was done, his dad was already sitting in the minivan waiting. Darwin hit the button on his phone and glanced at the screen. Damn, he had taken thirty-one minutes. His dad was a stickler for being on time; it was part of his OCD and difficult for him to control. It had been particularly tough when Darwin was a teenager. Everything was, especially after the accident, but they’d both worked hard and made it through that. Darwin set the house alarm and locked the door behind him, sprinting past his car to the van.
He pulled open the passenger door and dropped into the front seat. Even though he’d moved out of the house for university, his dad still gave him the look. Darwin tried to pretend it didn’t bother him, smiling at his dad to cover it up, but he wasn’t sure it worked. From the time of the accident to when he’d left for university, his dad hadn’t let him sit in the front, saying it was safer in the back seat. Darwin didn’t like it then, and he didn’t like it now. His dad didn’t say anything about it, though.
“I’m so glad you’re coming back today. We’ve both worked hard to get this project off the ground. Hell, the whole team has, but having you with me . . .” He paused and cleared his throat. “This project means more to me than I’ve said. If it works—”
“It’ll work, Dad. The preliminary tests had to have gone well, or you wouldn’t be running the full ones today.” It was Darwin’s turn to pause as a look of irritation crossed his dad’s face. “Sorry I interrupted, what were you going to say?”
“Nothing. I just . . . your mother would have been so proud of you.”
Darwin felt as though his dad had wanted to say more, but he knew better than to push. He couldn’t remember the last time he had even mentioned his mom.
“I know,” was all he said. He’d joined the physics department at Princeton because he knew it was what she would have wanted, knew how much joy she would have gotten in seeing her two boys work together. It had also, surprisingly, brought him and his dad closer. He hadn’t thought that was possible. Through all the surgeries and psychiatric sessions, as his school friends slowly stopped visiting, stopped caring, his dad had been there. Always willing to listen, or to talk, or to just sit in silence.
“Unfortunately, you won’t be able to do much more than watch,” his dad said. “Two weeks is a long time to be away from a project, and you’re not an intern anymore.”
Darwin nodded as his dad turned on the car radio. A shrill soprano voice belted opera over the speakers. He jammed his ear buds into place and turned up the volume on his phone, smiling as he tried to tune out the screeching. Some things would never change. He’d gotten his mom’s taste in music, thank god.
Thinking of her brought in more memories. She was never far from his thoughts, but this close to her birthday it was as if the accident had happened only yesterday, and the guilt and loss surged back to the forefront. He knew his dad had blamed him for the accident. Hell, he still blamed himself. They had both healed over time, even though some pain never went away. Through it all, they had grown closer as—for him anyway—the rest of the world had faded away.
Mom had been gone seven years, and he still missed her. He couldn’t remember what she looked liked—somehow the pictures on the wall beside the clock in the living room were different than what his mind conjured. Still, at night, he would sometimes wake from a dream smelling her hair from when she gave him hugs—apple blossom and vanilla—and feeling her arms around him.
She’d always given the best hugs in the world. They had made him feel safe. It was the single memory that he still carried with him every day.
The van bumped out of the driveway onto the dark street and crawled toward the expressway at a blistering twenty miles per hour. Why did he decide not to take his own car again? They picked up speed when they hit the expressway, but nowhere near the posted limit.
Several songs later, Darwin felt the van slow down and pull off the expressway. He removed the ear buds and turned off the music.
The Quantum Labs building stood across a small grassy boulevard planted with the occasional tree and a parking lot meant for visitors and upper management. Regular staff parked in the back. This early in the morning, most of the building was still dark.
The place had always given him the creeps. When he was kid, he had imagined the eight-story glass and steel structure waking up at night and lumbering on multiple stubby legs, hungry for whatever was in its path. This morning the glass reflected the rising sun, making it bleed red in small undulating waves.
It wasn’t the glass that bothered him, though; it was the entrance. Massive black stones wrapped the recessed, black steel doors. No matter what time of day it was, the rock seemed to suck the light into it. This morning the rippling red blood seeped into its open maw.
Darwin held back a shudder. He was too old to be imagining kid stuff.
The Quantum Labs logo, an italicized Q with the tail formed by an uppercase L, shimmered blue above the doors. It was the only splash of color on the black. His dad pulled into a spot across from the entrance, just past the visitor parking stalls. A few of the other spots had cars in them, including the ones reserved for the owners right by the door. Out of place was a single vehicle taking up a visitor’s spot. Military by the look of it. There must be meetings before the full power test.
“We’re going to see history made today,” his dad said. “When we push the QPS to full power, all of the world’s energy problems will disappear. Poof! Just like that. Even the smallest hovel in Africa will have enough power to air-condition their backyard.”
Darwin sighed. His dad had buried himself in this project for the last five years, and seemed to have fallen out of touch with the real world. “I wouldn’t use that one at the press conference, Dad. I kinda doubt anyone who lives in a hovel in Africa,” he made quotation marks in the air with his fingers, “has a backyard. Or an air-conditioner.”
“No, I guess not. I won’t be talking anyway, that will be up to the executive and whoever the military sends. I’m just the worker bee on this one.”
“You’re more than that. Without you, this project wouldn’t have made it. There’s a lot of you in every piece of software and hardware in the QPS.”
His dad’s steps faltered for a second before he continued to the front entrance.
Darwin forced a smile onto his face, the same thing he did every morning when he worked here, and followed his dad inside.
The reception area was airy and open, a stark contradiction to the outside of the building. The early morning sunlight, filtered through the tinted glass and mixed with the LEDs high above them, lit the space with a warm glow that contrasted with the sterile chrome and glass balcony that wrapped around the open atrium on two sides. A wide staircase curved down to connect the balcony with the main floor. The Quantum Labs logo hung from the ceiling, suspended on two thin, quivering cables. It swayed slightly in an otherwise unseen breeze.
Behind the dark wood counter that spanned the room, the only natural item in the atrium, sat two receptionists, one typing on his computer as if it were the only thing in the world that mattered, and the other looking up and smiling as they walked in. They’d probably been asked to come in early because his dad’s bosses were already in.
The smiling receptionist stood as they got near. “Good morning, Mr. Lloyd. We have Darwin’s guest pass ready. If he could sign in here.” She held the tablet out to Darwin. “Please verify the information is correct, and then sign on the dotted line at the bottom.”
He took the tablet and reached across the screen to unclip the stylus with his left hand, signing at the bottom without reading it, and passed it back. The receptionist slid a clip-on guest pass over the counter, the QL logo emblazoned across the top in blue metallic ink. Two weeks ago as an intern he’d had his own pass and could go almost anywhere in the building. Now he had to have an escort.
“Please wear this at all times while in the building, and return it when you leave.”
She sat back down, her job done, and ignored both of them.
Darwin followed his dad to a frosted glass door under the sweeping staircase and waited while he swiped a security card through the reader. The door buzzed and he pushed it open, leading Darwin through the bright white corridors to his office.
Garth, Dad’s second-in-command, was waiting for them, his tall frame leaning against the wall and a thick folder in his hands. Beside him stood Rebecca. A long curl of hair had slipped from her normally tight bun, and though Darwin had worked with her on the project, he was shocked at how red it looked under the LED lights of the hallway.
Garth’s tie hung loose below the undone top button of his shirt. He looked like he hadn’t slept in weeks. When he saw Darwin, he smiled and waved as Rebecca turned and walked away.
“Hi, Darwin, how ya doing? I forgot you were coming in today. The monitoring system you wrote for us is working great,” Garth said.
He clapped Darwin on the back as they followed his dad into the office. Darwin forced himself to not pull away from the touch, instead using the learned smile to respond to the greeting.
Garth lost his grin, turning all business in less than a step. “Henry, I’m not sure we should run a full test today.”
“Why on earth not?” His dad’s voice sounded shrill and too loud for the enclosed space.
Darwin sat down, tuning the arguing men out. Arguing, even if he wasn’t involved, always brought his reclusive tendencies to the forefront.
His dad’s office was the same as it had always been. The L-shaped desk in the corner looked like it had never been used. Three pens lay beside the computer’s keyboard, each perfectly square to the desk’s edge and an inch away from its neighbor. A framed picture of his mother sat to the right of the computer’s display. The round table Darwin settled down at took up another corner, the six chairs around it spaced evenly apart. Uncommonly, a stack of schematics and other documents sat on the table. It was a neat stack, perfectly centered, of course.
He picked the top document off the pile and scanned it. Computer code. It wasn’t from his monitoring system, or any of the other systems he had worked on. The rest of the papers in the stack looked like they were QPS related, so he figured it must be some internal routines. He flipped the page. A long chunk of code grabbed his attention. Most of it was a random-looking block made up of four letters, and ran for pages.
string accession = “NT_011387”;
short version = 9;
long reference_id = UNSPECIFIED;
string reference_name = “EL”;
string genome = “TGTTCAGTCGGGCAGGGAGTGGGAATAGACAAGAC
CACAAGCAGCTTGGTGCCTCTGAAAGGGAGAGGGG
TGGAGGGGAGACTAGAGAGGTGGGTAGGAATACTG
GATTCCACTGACCACGTGCTGGATGTCATGCTTAG
CCCTCCTGCTCTGTGCCAGGTTAGGCACCTGGTGT
TTTACATATATTATATTACATTCTATTACAGACAA
CTCCATAGCAATCCTTTCCTCTCCATTCCATTTCT
CTCCACTCCATCCCATTCCATTCCACTCCCTTCAT
. . .
He drew the paper closer. He was more a mathematician/physicist than a geneticist, but he recognized a DNA sequence when he saw one.
“Yesterday’s runs were clean.” His dad’s voice was raised again, drawing him back into the conversation. “Our four-thirty test was the best yet. We all agreed today would be the day.”
Darwin sat straighter in his chair, suddenly paying more attention, the DNA sequence forgotten. Four-thirty was pretty close to yesterday’s episode, just before he went into the house and fell asleep and had the weird dream about the Coke cans.
“I know, but I took another look at the readings last night.” Garth opened the folder he was holding, placing it on the desk and pushing the pens out of the way. He pointed at the papers inside. “Look here, right when we went to seventy percent. The quantum force isn’t as uniform as we’d predicted. We’re starting to see fluctuations.”
“You’re not the only one who went over the data last night. Those values are still inside the calculated norms.” Dad reached for his pens to straighten them out.
“They are, but each time we raise the power, the fluctuations increase. They’ll be pushed right to the boundaries if we go to one hundred percent. This is uncharted territory. What if our calculations are wrong?”
“I agree they’re close, but I still think we’ll be fine. Those values were conservatively calculated, so if we’re inside them, we still have a safety margin. You know that. Besides, if we don’t run a full test today, management will be breathing down both our necks. We’re over budget and months behind schedule. We have to show them something. If we don’t, they may pull funding.” His dad paused. “I think we’ll move forward with the test.”
Darwin could tell his dad was tense. He was sitting straighter in his chair and struggling not to reach for Garth’s folder to straighten out the papers.
“Henry—”
“Look,” his dad said. “Run through the values again. As long as we’re within the one percent margin of error, we’ll go ahead as planned. Anything else and we’ll wait, okay?”
“Okay. It’ll take some time.” Garth sighed in frustration as he picked the folder up off the desk and turned to leave. “Enjoy your day, Darwin.”
Darwin’s dad put the pens back in order before turning around. “Make yourself comfortable. We won’t run the tests until Garth has gone through all the numbers.”
“You want me to help him?” Darwin asked.
“No. You don’t have the clearance anymore. I had to pull some strings just to get you in for this test.”
A wave of disappointment washed through him, and he pushed it away. He knew something like this would happen when he’d left, but hadn’t expected how it would make him feel. He switched tracks, hoping to get his dad talking.
“Okay. Hey, Dad? What’s with this DNA sequence mixed in with the QPS code?” He held up the printout and pointed at it.
“What?” His dad jumped from the chair and grabbed the document out of Darwin’s hands. “That’s . . . that’s nothing. It’s a completely different project. You shouldn’t have seen it, it’s highly classified. Damn cleaners.” He opened a drawer in his desk and jammed the printout inside before sitting back down, touching and moving each pen multiple times to make sure they were aligned properly. He did the same thing with his keyboard and monitor.
Darwin leaned forward in his chair, his mouth hanging open. He’d never seen his dad so flustered that he didn’t care where something went. Throwing the paper in a drawer and closing it was so far beyond normal that he wouldn’t have believed it if he hadn’t seen it, and that was probably why his dad was regressing to excessive behavior with everything else.
His dad’s back was ramrod straight, making Darwin too nervous to ask any more questions. His dad gradually regained control, slowing down the furtive movements, before finally turning the monitor on.
Darwin fought the urge to approach him, to try to help in some way. Past experience had taught him it was better to leave his dad alone when he got this agitated. He would calm down eventually, and they would both pretend nothing out of the ordinary had happened.
“You can go visit the other teams, if you want. I can have our new intern walk you around. Can’t have a visitor unescorted, you know.”
The thought of having to interact with the people he’d worked with made his insides feel like they’d shriveled into a ball. He could do it when he had to, when it was his job, but just visiting them because he was here was out of the question.
“No, I’m okay. I’ll just wait here until you’re ready.”
“Suit yourself.”
Apparently they had both learned how to best deal with each other’s issues over the last few years. Darwin pulled out his phone and plugged in his ear buds again, starting on a new playlist while his dad worked. He opened with some Ry Cooder “Vigilante Man” and Eric Clapton. It was old, but he’d fallen in love with it as much as his mom had.
He hadn’t been an outgoing person before the accident, and after she’d died, he’d practically turned into a hermit. Her music had been the only thing that kept him going during the early days when he’d lain in the hospital bed staring at the light blue ceiling with its flickering fluorescent bulbs. Whoever thought a sixty hertz power supply was adequate hadn’t been thinking about the refresh rate of crappy lighting.
Over the years, he’d added some new music to the list, stuff like Rag’n’Bone Man and Robert Johnson. The psychiatrists had said the music was his way of escaping, of getting away from anything that made him uncomfortable. Mainly people. Maybe that was true, but he didn’t care.
He was almost through his playlist by the time his dad was ready.
Despite his best efforts, he wasn’t able to get his dad’s reaction out of his head, but the only thing he could think of talking about was Garth’s worry over the numbers.
“What if the test fails?” Darwin asked.
His dad looked at him like he was nuts. “You went through a fair amount of the math when you worked here. Do you think it will fail?”
Darwin shrugged. He didn’t have the results of the previous runs. How was he supposed to know? But now, he wanted to look through them. He followed his dad through another set of security doors and past small labs assigned to other projects before heading down into the basement. He’d had a brief stint with the quantum internet project before he’d moved to the QPS. One of the people on that project waved as he walked past. He pretended he hadn’t seen it.
At the entrance to the lab, a rack of blue anti-static smocks stood ready to be used. His dad grabbed two, shoving one into Darwin’s hands before putting on his own.
The lab hadn’t changed much since he was last here. With the testing going live, he had somehow imagined it would be a bit different.
“I don’t think the QPS was fully assembled last time you were here. It’s powered up, if you want to see it. Not much to look at really. It’s right through the window over there.” He turned his back on Darwin, facing a large bank of monitors. “Hey, Garth, are we ready?”
Garth towered above the dozen or so people moving around the room, watching everything that was going on around him.
“Ready when you are. The fluctuations are within point two percent.”
Darwin moved to the window looking into the partitioned lab space. On the other side of the clear glass sat a simple gray box about the size of a small car. Wires ran out of it in bundles, connecting in a large sheath before entering the wall with the window. They didn’t come directly out his side. A single thick cable rose out of the top of the QPS and lost itself in the trusses and conduits on the ceiling. The Quantum Labs logo glowed blue on its side, seeming to jump off the dull gray of the machine. It looked smaller fully assembled than he thought it would.
“The recorders are running,” said Garth.
“Okay. Bring her up to fifty percent and let’s check the readings,” Dad said.
The pain in Darwin’s head started right away, followed by the incessant buzzing that had accompanied it for the last two weeks. The noise started low, as a simple background hum he could easily ignore, before moving into a range that filled the room and forced its way to the foreground. He reached for his pocket, realizing that in the morning rush, he’d forgotten to refill his daily stash of Advil.
“Hey, Dad, is it the QPS making that sound?”
“Hmm, what sound?” His dad stared at the numbers flashing across the displays in front of him. “It doesn’t make any noise, Son. You’re imagining things.”
“Fifty percent and holding,” said Garth.
“We knew we could do that. Let’s move her up to seventy-five percent.”
“Higher than yesterday?”
“That’s our goal, isn’t it, to finally go to one hundred?”
The buzzing in Darwin’s head increased with the pain, and the voices in the lab sounded hollow and distant. For the first time, the buzz was directional. He turned to face the sound, leaning on the windowsill, and focused on the machine. There was no indication it was even working.
The glass cracked and he stumbled back.
The window shattered, throwing shards into the lab. He ducked instinctively and turned his back on the flying projectiles before twisting around to stare at the empty frame and the QPS behind it.
The machine was wrapped in a fine mist that billowed into a thick fog. The surface roiled and threads shot out before collapsing back into the cloud, coiling gently across the surface only to shoot out again like solar flares. It was the Coke can all over again, but stronger, more vivid.
He blinked and suddenly the QPS room was filled with people in blue smocks. Unlike the one his dad had handed to him, these were dirty and the cuffs had been worn down to almost nothing. Wispy threads snaked out from the machine’s surface, reaching out and caressing the group, swirling around each individual in intricate patterns before they passed on to the next person. Darwin’s stomach clenched and his heart pounded. He couldn’t have another episode. Not here. Not now.
The image solidified into crisp detail. A woman with red hair seemingly controlled the threads moving between all the people . . . twelve of them standing in a circle around the machine. The people blurred once again. Two stood out from the rest, their dark wavy hair and gray eyes matching his memories of his mother. The threads linking them to the machine looked thicker than the others. His mind refused to believe what it saw, knowing it to be as impossible as dry water or good-tasting sushi.
“Go to full power. Keep an eye on the readings.”
His dad’s voice cut through the hornet’s nest in his head, sounding like a distant echo of the real thing.
Darwin spun. “Stop! There are people in there.” Couldn’t he see for himself? Didn’t he care?
The lab sheared and became two. Both labs shifted again and then there were four. Then eight. Each lab was different, juxtaposed over the others, making the differences stand out more than the similarities. The pain in his head surged.
This was different. It was as though this time, the images he was seeing were being controlled . . . guided by an invisible hand. He leaned against the window frame again, his legs suddenly weak.
The wood frame changed to metal under his fingers. Glass filled it again. Embedded in the glass was a fine mesh of wires, strengthening it. Without warning, the wall disappeared and he stumbled forward into the QPS room. The floor changed to grass, then snow, then steel before disappearing into a pit of nothing. He fell into the murky abyss, feeling the pull of a thousand hooks on his body, wanting to tear him into shreds and spread the pieces throughout the universe. His mind fractured and time slowed.
Something grabbed him, gathering the pieces, holding him together in a warm cocoon of light. Pulling him back to reality.
The world snapped back into focus. He was in the QPS room, on the other side of the wall to the lab, his back to the broken window. He wheeled around, tripping over his own feet, staring through the shattered glass. His dad’s lab was constructed of the misty threads. Through them, he could see other images, the other labs.
In one image, equipment lay shattered and ruined on the floor. In another, people lay around the room, either dead or unconscious, and the displays flickered into oblivion. In the third, maybe the fourth, his dad typed feverishly at a console, deep in concentration. He had a beard, long and scraggly and unkempt, streaked with white. He looked like he hadn’t slept or eaten in days.
Threads made of the finest gossamer, thin and translucent, moved in a dance that wove around everything, flowing through the empty spaces between the equipment, tying the disparate images into a living whole.
Chanting voices made him turn back to the QPS. Unlike his dad’s lab behind him, there was only one image here. The blue smocks of the people were covered by cloaks of threaded light, moving and curling in patterns that never repeated. One person left the chanting circle, pulling several of the threads along with him as though they were obeying his commands. Darwin stood mesmerized as the remaining figures followed. He felt himself pulled inexorably toward them.
Ice shot through his veins and his breath froze in his lungs. Crystals of cold covered his eyes, fracturing everything he saw.
A blur stepped in front of him, and he forced his eyes closed and open again. An eternity for a task that should have taken milliseconds. Threads shifted in front of him, revealing a face. A mass of auburn hair fell forward, briefly covering soft brown eyes. He realized it was a woman. He’d seen her before, but he couldn’t remember where. Her forehead was creased in confusion as she hesitantly reached out and touched his arm.
Red hot pain seared through his head, pushing daggers of fire into his mind. He fell forward, the concrete floor of the QPS room looming in his sight before the world turned black.
Darwin felt a cool hand caress his forehead, tracing one of his old scars down his cheek to his chin as if the person doing it could see through the plastic surgeon’s work. The sensation of being pulled from a dark well flooded him, and the hand was removed.
“He wakes.”
A soft voice. Feminine.
Memories of his mother filtered to the front of his mind, of her gentle touch when he was hurt, of the loss he’d endured when she had died, which he still felt. For a brief moment he thought he smelled vanilla. He forced his eyes open. A flash of bright light was quickly replaced by a halo of dark red hair falling toward him. He blinked, once, twice, struggling to bring everything into focus. The face above him creased into a gentle smile, the fleeting look of concern vanishing as if it had never existed.
“Hello, Darwin. Can you sit up? You hit your head pretty hard against the window frame when you fell.”
He pulled back before reaching up to touch his forehead. His fingers came away bloody.
“Wait,” she said. “We need to get the cut cleaned up. We can have a healer come in to take a look at it.”
“A . . . a healer?”
“Yes.” Her brow creased slightly. “Ah, of course, a doctor. It’s been so long.”
He pushed himself upright. His head swam with a sudden wave of dizziness and nausea. He forced himself to focus on the window behind the woman with red hair, trying to push through the queasiness. There was no glass in the frame, or on the floor. Everything looked blurry. Dim curls of light, the last remnants of the wisps he had seen earlier, swam through his vision before slowly fading away.
“What happened? Where’s my dad?” He struggled to look through the wall of blue smocks surrounding him in a loose circle. Through the gaps he could see desks and computer equipment, but it was different. Nothing was turned on. Half of the fluorescent tubes in the ceiling were on, the others dark or broken.
He looked over the woman’s shoulder and saw the top of the flat gray box. A portion of the blue QL logo glowed, barely visible from his angle.
“Dad?” Panic rushed in and he started to shake, his muscles twitching uncontrollably. Shifting his weight, he forced himself onto his knees. The pain in his head almost made him sit down again. Another wave of nausea rolled through him and he squatted back down on his heels, his chin lowered to his chest as he drew in long slow breaths.
On his third inhalation, reality hit like a cresting wave, driving him to his hands and knees. His breathing was no longer deep, but short shallow sips. The air tasted musty, filling his mouth and nose.
The smocks. The anti-static jackets were filthy and tattered. Just like he’d seen through the window before it exploded.
Where was his dad?
“Dad?” His voice sounded sharp, cracking at the edges as fear clutched at him. He couldn’t stop the uncontrollable shaking taking over his body. “Dad!”
“Your father isn’t here, Darwin.”
Hands pulled on his shoulders until he was sitting on his heels again, holding him steady as his body continued to betray him. The woman with the dark red hair crouched down in front of him. Recognition flickered through Darwin’s mind again, disappearing as fast as it came.
“There’s a lot you—and we—need to know, but first we need to get you calmed down and get that cut in your forehead taken care of before it gets infected. Take a deep breath and let it out slowly. You’re hyperventilating.”
Black spots danced in front of his vision as he drew in another shaky breath and held it before slowly releasing it through his mouth. He did it again, and the spots faded. His body still vibrated, twitching under the skin.
“That’s it, nice and slow.”
After a few breaths his nausea subsided, but the panic squeezing his chest refused to let go.
“Good. Can you stand? We’ll get you upstairs and fix you up. Do you think some water would help?”
She stood without waiting for him to answer and beckoned two men from the loose circle around him. They reached under Darwin’s arms, pulling him roughly to his feet. The room tilted and the black spots threatened at the edge of his vision again.
“Be careful, he’s our guest.” Her soft voice became rougher and commanding as she looked at the two men. “Bring him upstairs. Put him in the big front office. Wait outside the door for the healer.”
The two men turned Darwin around and walked him out of the lab to the stairs. Even with the almost irresistible fear that still threatened to take over, he noticed some of the equipment was missing. The large overhead displays were nothing but empty brackets on the ceiling, and at some of the desks only a pool of wires lay on the dusty tops. Just as they left the lab, he heard the woman’s voice again.
“Somebody tell me what the hell just happened.”
His feet caught the bottom stair up to the main level and the two men took his weight with a grunt, carrying him most of the way up. He couldn’t seem to get his brain to work properly. The hallway at the top was lit, but every second fixture was off, leaving the space darker than he was used to. The men led him past his dad’s office—the only thing to show it used to contain furniture was the indentations in the carpet—and through the frosted security door to the front atrium. The sudden light coming from the windows made his eyes water as he was dragged to the staircase and hauled up to the second-story balcony. They led him to a large room at the front of the building and put him inside, closing the door as they left. He heard the faint scraping and thud of a lock driving home.
One entire wall of the office was glass with an impressive view. He could see over the trees surrounding the parking lot, out to the expressway and beyond into the next industrial park.
No cars moved. A few sat in the parking lot below him and there were a couple on the expressway, the sun glinting off their windshields.
Everything looked as still as a photograph.