The Y chromosome (right) is smaller than most other chromosomes, including the X chromosome (left), but it contains genetic information valuable to genealogists. Image courtesy of Jonathan Bailey of the National Human Genome Research Institute.
Is that Smith ancestor born in Virginia in 1718 the son of John Smith or Hiram Smith? How many men do you have in your family tree who have no identified father, or that after decades of research you are convinced must have been dropped on Earth by aliens? Y-chromosomal (Y-DNA; image A) may be able to help you solve some of these mysteries. Since the Y chromosome is passed down along with the surname in most Western cultures, it is exceptionally useful for examining and breaking through the brick walls of our paternal lines. In this chapter, we’ll learn about Y-DNA and how to add this kind of testing to your genealogical toolbox.
The Y chromosome (right) is smaller than most other chromosomes, including the X chromosome (left), but it contains genetic information valuable to genealogists. Image courtesy of Jonathan Bailey of the National Human Genome Research Institute.
The Y chromosome is one of the twenty-three pairs of chromosomes found in the nucleus of a cell and is one of the two sex chromosomes (the other being the X chromosome). While a female has two X chromosomes (see chapter 7 for more about the X chromosome), a male has one X chromosome from his mother and one Y chromosome from his father. As a result, the Y chromosome is found only in men, who inherit it almost entirely unchanged from their fathers.
The Y chromosome is approximately fifty-nine million base pairs long, which is actually very short for a chromosome. The chromosome contains approximately two hundred genes, just a small fraction of the estimated twenty to twenty-five thousand genes found throughout the entire human genome.
Similar to mitochondrial DNA (mtDNA; chapter 4), Y-DNA has a unique inheritance pattern that makes it valuable for genetic genealogy testing. The Y chromosome is always passed down from a father to his son. The father’s cells make an exact copy of this Y chromosome and pass that down to his sons through his sperm. Note that if a man has only daughters, his Y chromosome is not passed on to the next generation.
Unlike all other chromosomes, the Y chromosome is always unpaired, meaning that it does not exchange DNA with another Y chromosome in a process called recombination. Although the tips of the Y chromosome and the X chromosome will sometimes recombine, these regions of the Y chromosome are not utilized for genealogical research or haplogroup determination. As a result, the Y chromosome that a father possesses will almost always be identical to the Y chromosome of his sons.
Image B shows the inheritance of the Y-DNA within a family tree. John decides to test his Y-DNA and reviews his family tree to see from whom he inherited that piece of DNA. John inherited the Y-DNA from his father, Kyle, who inherited the same Y-DNA from his father, Liam, who inherited it from his father, Matthew.
Y-DNA is passed down the paternal line (in blue).
At each generation, only one ancestor carried John’s Y-DNA, and due to the unique inheritance pattern, John knows exactly which ancestor that is even though he may not know his name or identity. For example, John has 1,024 ancestors at ten generations, a total of 512 men and 512 women. Although every one of those 512 male ancestors had a Y chromosome, only one of them passed down his Y chromosome to John.
Knowing the inheritance pattern of Y-DNA also gives genealogists the ability to trace this piece of DNA forward through a family tree. Let’s say John is a great-grandfather and would like to know which of his descendants carry his Y-DNA. Image C is John’s family tree, in which blue-labeled individuals carry John’s Y-DNA. Only two of John’s children, his two sons, carry John’s Y-DNA. At the great-grandchild level, two of John’s great-grandchildren (3 and 4) carry his Y-DNA. For Y-DNA, a female is always a dead end in the line.
John’s descendants who have his Y-DNA are in blue; notice great-grandchildren 3 and 4 have John’s Y-DNA, but 1, 2, and 5 don’t.
In the previous chapter, we learned that if every human on earth could trace back their maternal line they would all merge on a single person: a woman called “Mitochondrial Eve” who is the mtDNA ancestor of all living humans. Similarly, if every man on earth could trace back his paternal line they would all merge on a single person, a man called “Y-chromosomal Adam.” He is the most recent common ancestor (MRCA) of all humans on their paternal line (but not on all lines).
Y-chromosomal Adam’s identity has been long since forgotten, yet we know a few things about him. First, we know that he probably lived about two hundred thousand to three hundred thousand years ago based on the number of mutations that are found in modern-day Y chromosomes. Using current information about the mutation rate of Y-DNA, it would have taken approximately two hundred thousand to three hundred thousand years for all the observed variations to arise. Second, we know that Y-chromosomal Adam likely lived in Africa. And third, we know that Y-chromosomal Adam had at least two sons who each gave rise to different lines of the Y-DNA tree.
Similar to Mitochondrial Eve, “Y-chromosomal Adam” has his name’s origins in the Bible. However, he was not the only man alive at that time and is not the only one of his contemporaries to have living descendants. Thousands of other men likely lived at that time and have living descendants but at some point between then and today “daughtered out” or had a final Y-DNA descendant in each of these other lines who failed to produce a son.
The date of Y-chromosomal Adam is not a fixed point in time. Even today, old Y-DNA lines are dying out and new Y-DNA lines are being created, which can move the date of Y-chromosomal Adam. Additionally, new Y-DNA lines may be discovered that could push back the date of Y-chromosomal Adam. For example, a paper published in 2012 revealed that an entirely new root haplogroup had been discovered in African-American test-takers, thereby pushing back the date of Y-chromosomal Adam. This new root, called A00, is older than the original Y-chromosomal Adam, and therefore a new Y-chromosomal Adam was identified. As more men are tested around the world, particularly in Africa, it is possible that other root haplogroups could be identified and the date of Y-chromosomal Adam could be pushed back further in time.
A male can take a Y-DNA test to examine his own Y-DNA line. A female, however, will have to ask her brother, father, or uncle (or another male relative) to take a Y-DNA test. And any genealogist tracing another piece of Y-DNA will have to find a living male descendant who is willing to take a Y-DNA test. Sometimes, however, an ancestor may have no descendants who carry his Y-DNA, even if they have many descendants. In this case, the Y-DNA is said to have “daughtered out.”
In the example in image D, Ralph has no living descendants with his Y chromosome. Ralph had one son and three daughters, and his son had only a daughter. Accordingly, Ralph’s Y-DNA has daughtered out.
If you’re having trouble finding a living descendant who has your ancestor’s Y-DNA and is willing to take a Y-DNA test, work back another generation to find a more distant cousin who can help. Here, Carl has the same Y-DNA as John even though he’s not one of his direct descendants.
However, it may still be possible to find a relative who possesses Ralph’s Y-DNA. By going back a generation and working forward to determine whether there are any living Y-DNA descendants, a genealogist may find a living male relative willing to take a Y-DNA test. In this example, Ralph’s father, Simon, possessed the same Y-DNA as Ralph and passed it down to Ralph’s brother and down through a line to the living male descendant, Carl.
If Simon had no male descendants who carried his Y-DNA or no descendants willing to take a DNA test, a genealogist could go back yet another generation and work forward. There is no limit to how many generations back a genealogist can go to find a Y-DNA relative, although, as discussed later, a genealogist should consider the increasing possibility of misattributed parentage with every additional generation.
Normally, the Y chromosome is transmitted from one generation to the next almost entirely without change. Over time, however, the Y chromosome can accumulate one or more mutations that—while typically harmless and not affecting a man’s health—can be detected by a test and be useful for genealogical analysis.
Two Y-DNA tests for genealogy are available: Y-STR tests and Y-SNP tests (image E). Y-STR tests, or “Short Tandem Repeat” tests, sequence between 12 and 111 (and sometimes even more) very short segments of Y-DNA at locations all along the Y chromosome. Similarly, the Y-SNP test, or “Single Nucleotide Polymorphism” test, examines between one and hundreds of single spots along the Y chromosome. In this section, we’ll discuss how these tests work and the pros and cons of each.
Genealogists have two Y-DNA tests to choose from: Y-STR testing that sequences the number of repeated segments and Y-SNP testing that tests specific points of DNA (SNPs).
Y-STR markers, central to this type of Y-DNA testing, are identified by their DNA Y-chromosome Segment (DYS) number and measured by the number of repeats of a particular DNA sequence at a particular location. The results of Y-STR testing are usually presented with a DYS name and the number of repeats for that particular marker.
The DYS name identifies which specific location along the Y chromosome is being analyzed, and the number of repeats identifies how many repetitions of a nucleotide sequence are found at the location being analyzed. For example, DYS393 is an STR located at a specific position on the Y chromosome, and usually has between nine and eighteen repeats of the sequence AGAT, with thirteen repeats being the most common. A DYS393 result of 9, for example, means that there are nine repeats of the AGAT sequence at that location:
…ATACAGATAGATAGATAGATAGATAGATAGATAGATAGATACTA…
The results of multiple Y-STR markers are typically presented in a table with the DYS marker name in the top row and the number of repeats for each marker in the next row.
Together, the results of an individual’s tested Y-STR markers represent the individual’s haplotype, the collection of specific marker results that characterize that test-taker. Every male has a specific Y-DNA haplotype, and generally the more similar the haplotypes of two males, the more closely related they are.
Most Y-STR tests examine between 37 and 111 STR markers, but many more STRs are being identified and used for testing. Family Tree DNA currently offers 37-marker, 67-marker, and 111-marker Y-STR tests. The 67-marker test, for example, contains all of the markers from the 37-marker test, plus an additional thirty markers. Similarly, the 111-marker test contains all of the markers from the 67-marker test, plus an additional forty-four markers. The more Y-STR markers that are tested, the greater the resolution of the estimated relationship between two compared males.
The number of repeats at a particular Y-STR can change over time at a relatively regular rate, thereby giving genealogists the ability to trace patrilineal lineages over time. A father and son, for example, will almost always have the same Y-DNA haplotype. Occasionally, a mutation occurs in one or more of the Y-STR markers between one generation and the next. For example, nine repeats at DYS393 can become ten or even eleven repeats due to a random error. The rate of errors is relatively regular, meaning that the differences between two haplotypes work as a “clock” to estimate how many generations have passed since two men had a common ancestor. DYS393 has a very slow mutation rate of 0.00076, or approximately one mutation in every 1,315 transmission events, on average. However, despite this slow mutation rate, a mutation in DYS393 can randomly occur at any time, leading to a father and son differing at this marker.
Some Y-STR markers have a tendency to change more rapidly than others. In contrast to DYS393’s slow mutation rate, for example, DYS439 has a mutation rate of 0.00477, or about one mutation in every 210 transmission events, on average. When comparing the Y-STR results of two men, consider whether they differ at fast markers and/or slow markers. For example, if the two men differ at only “fast” markers, it is likely—but not guaranteed—that their common ancestor could be significantly more recent than two men who differ at only “slow” markers. Family Tree DNA identifies “faster changing STR markers” in Y-DNA surname projects by highlighting them in red. See <www.familytreedna.com/learn/project-administration/gap-reference/colors-y-dna-results-chart-heading> for more information.
The sample results also identified the Y-DNA haplogroup of the test-taker as R1b1b, though this is just an estimate based on the results of the Y-STR test. (Similar to mtDNA haplogroups, Y-DNA haplogroups are named by letters of the alphabet, and a particular Y-DNA haplogroup result can provide information about the ancient origins of the test-taker’s patrilineal line. However, haplogroups can only be estimated by Y-STR testing and are actually defined by Y-SNPs.)
And what can these tests do for you? Y-STR tests are essential for estimating the relatedness between two males. Since Y-STRs exhibit a relatively constant mutation rate, the number of differences between the Y-STR profile of two people—their haplotypes—can be used to estimate the time since those two people shared a common male ancestor. One mutation will mean a more recent common male ancestor, while ten mutations will mean a very distant common male ancestor. Accordingly, Y-STR results are extremely useful for examining genealogical questions involving male lines.
In the past, the naming convention for Y-DNA haplogroups added a number or a letter for each new branch of the tree. However, as new branches were discovered, the haplogroup names became too long to be useful. A new naming convention, called the terminal SNP, is now most often used for haplogroup naming. For example, the test-taker’s terminal SNP in the R1b1a2a1a1 example is R-U106, which is the most distant branch to which he can be mapped.
Y-SNP testing examines hundreds or thousands of SNPs—variable nucleotides A, T, C, and G—all along the length of the Y chromosome. Y-SNPs are traditionally used to determine a test-taker’s Y-DNA haplogroup and ancient ancestry, but not as useful for finding genetic cousins in the testing company’s database. However, new tests are identifying SNPs that may be useful on a genealogically relevant time frame. These so-called “family SNPs” are mutations that developed within the past few hundred years. While there is no test available specifically for family SNPs at the time of this book’s publication, these types of tests will probably be available in the near future.
The results of a Y-SNP test can have several important uses. For example, Y-SNP testing accurately determines the test-taker’s Y-DNA haplogroup and reveals information about the ancient ancestry of the patrilineal line. Since SNPs are used to define Y-DNA haplogroups, the results of a Y-SNP test can also confirm an estimate or redefine a haplogroup estimate that is based solely on Y-STR results.
In addition, each SNP in the results helps place the test-taker on a branch of the human Y-DNA tree. Every SNP result will be either ancestral, meaning the test-taker does not have a mutation at the particular SNP, or derived, meaning the test-taker is mutated at that SNP. SNPs and their ancestral or derived classification help define the test-taker’s location on the human Y-DNA haplogroup tree. For example, an individual will be derived for the SNPs that define the branch of the Y-DNA haplogroup tree where they belong.
In the following table, for example, the test-taker’s Y-SNP test results reveal that his Y-DNA belongs to haplogroup R1b1a2a1a1, one of the most common Y-DNA haplogroups in Europe. In this example, the first SNP result, M269+, indicates that the test-taker is derived at that SNP. At L277, however, the test-taker is ancestral (hence, L277-).
In this simplified Y-DNA haplogroup tree, the most distant branch of the tree to which the test-taker can be mapped is R-U106, otherwise known as R1b1a2a1a1 (image F).
Y-DNA haplogroups (such as these that start with the letter R) are assigned based on whether an individual is ancestral or derived at various DNA segments (SNPs).
The human Y-DNA haplogroup tree is far from complete. New branches are constantly being discovered as more men undergo Y-DNA testing. Returning to the previous example, if a new branch of the Y-DNA tree were to be discovered underneath U106, and the test-taker was derived at the SNP that defined that new branch, his terminal SNP would change to the more distant branch of the tree (R-NEWSNP; see image G).
New branches (such as R1b1a2a1a1a) are constantly being added to the Y-DNA haplogroup tree.
The International Society of Genetic Genealogy (ISOGG) maintains an extensive Y-SNP Index <www.isogg.org/tree/ISOGG_YDNA_SNP_Index.html>, as well as a detailed Y-DNA Haplogroup tree <www.isogg.org/tree/index.html> with a separate page for each haplogroup. In addition to a map of the tree for each haplogroup, the ISOGG site includes a brief description of the haplogroup’s origin, a list of primary references, and a list of additional resources.
Y-DNA tests have many important applications to your genealogical research. For example, the results of a Y-DNA test can be used to determine the Y-DNA haplogroup of a particular line, find DNA cousins or paternal ancestors, and answer genealogical questions. Y-DNA can also estimate the length of time since two men shared an MRCA on their direct patrilineal line and be used to determine, for example, whether two men could have been brothers or father/son, among other relationships. In this section, we’ll discuss each of these uses in depth.
The results of Y-STR testing will provide a haplogroup estimate, while the results of Y-SNP testing will provide a more definitive haplogroup determination. All Y-DNA haplogroups, which are named with letters and numbers, descend from Y-chromosomal Adam. From Y-chromosomal Adam forward, major branches of the Y-DNA family tree indicate new haplogroups and minor branches indicate subgroups (or subclades) of that new haplogroup (image H). Each branch, whether major or minor, is defined by one or more SNP mutations. Although some SNP mutations are found in multiple branches, usually a branch contains a number of mutations so a Y-DNA sequence can be properly assigned to the correct haplogroup.
Major groups of Y-DNA haplogroups (called subclades) can be mapped in accordance with how they evolved from Y-chromosomal Adam.
The test-taker can then utilize the haplogroup designation to learn about the ancient origins of the direct patrilineal line. For example, the Y-DNA Haplogroups page at WorldFamilies <www.worldfamilies.net/yhaplogroups> is a good resource, with brief introductory information about the different Y-DNA haplogroups. Some Y-DNA haplogroups have multiple sources of information available. Occasionally, these sources will have information that appears to be conflicting, but this shouldn’t be cause for alarm as researchers are still learning about the human Y-DNA tree. Y-DNA haplogroup descriptions will continue to change as scientists learn more about the Y-DNA tree.
You can use the results of a Y-STR test to find genetic cousins who share a direct patrilineal ancestor. The test-taker’s Y-STR haplotype—the collection of numerical results at each of the tested markers—is compared to every other Y-STR haplotype in the database, and other test-takers with sufficiently similar results are identified. Usually, two haplotypes must be as close as, or closer than, a minimum threshold set by the testing company in order to be identified in the test-taker’s genetic cousin list. The more similar the test-taker’s haplotype and the patrilineal cousin’s haplotype, the closer the common patrilineal ancestor was to them in time and generational distance.
Only Family Tree DNA offers the ability to compare a test-taker’s Y-STR test results to a large Y-STR database. With more than five hundred thousand Y-STR test-takers in the company’s database, you’re more and more likely to find a patrilineal cousin when taking a Y-STR test.
An individual taking a Y-STR test from Family Tree DNA receives a list of people in the database who have identical or very similar Y-DNA. These individuals are Y-DNA cousins and are related to the test-taker through the patrilineal line. Some may have identical Y-DNA, while others might differ by a handful of STR differences. Generally, the more similar the Y-STR profiles of two men, the more closely those two men are related.
For example, in image I, the individual has taken a 67-marker Y-STR test from Family Tree DNA. There are eight other test-takers in Family Tree DNA’s database who have Y-DNA similar enough to the test-taker’s Y-DNA to be shown in the list. However, these individuals have a genetic distance of 2 or more, meaning that the Y-DNA results, or haplotypes, are not identical; instead, they differ by two or more mutations.
These results from Family Tree DNA describe the relationship between the test-taker and his DNA matches, including the genetic distance, haplogroup, and (for some matches) the most distant ancestor.
Genetic distance is calculated by adding together the difference between the results for each marker where the two test-takers differ. In the following example, the two test-takers differ by a value of 1 at two different markers and have a genetic distance of 2:
In this example, the two test-takers differ by a value of two at one marker, and thus also have a genetic distance of 2:
The genetic distance provides insight into the amount of time and number of generations that have elapsed since two test-takers shared a common patrilineal ancestor. For example, at sixty-seven Y-STR markers, a genetic distance of 0 indicates a more recent common ancestor while a genetic distance of 7 indicates a much, much older common ancestor.
The table below (adapted from Family Tree DNA’s “Expected Relationships With Y-DNA STR Matches” <www.familytreedna.com/learn/y-dna-testing/y-str/expected-relationship-match>). breaks down how closely related Y-DNA matches are across multiple tests, by genetic distance:
If a test-taker has only taken a 37-marker test (or an even older test with fewer markers), upgrading to a 67- or 111-marker test could provide additional insight into the genealogical relationship between two men. For example, it is possible that a genetic distance of 2 at thirty-seven markers will remain 2 when upgraded to sixty-seven markers, which suggests a much closer genealogical relationship than was observed at thirty-seven markers. In contrast, it is also possible that a genetic distance of 2 at thirty-seven markers will increase to 3 or more when upgraded to sixty-seven markers, which suggests a more distant genealogical relationship than was observed at thirty-seven markers. Genetic distance can increase, but should never decrease, with additional Y-STR testing.
Family Tree DNA also provides a statistical analysis of the distance between two test-takers that have similar Y-STR haplotypes. This statistical analysis is called the Family Tree DNA Time Predictor (FTDNATiP). The FTDNATiP analysis can be performed on any of a test-taker’s list of individuals with similar Y-DNA, and can be found by clicking the orange box labeled TiP on the Matches page (image J).
Family Tree DNA’s FTDNATiP will calculate the probability that you shared an ancestor with your match.
FTDNATiP compares the results of the test-taker and his identified match, and calculates the time to the most recent common ancestor (TMRCA) using a patented algorithm that utilizes the specific mutation rate for each of the markers where there is a difference between the two men.
In the following example (image K), the two test-takers have a genetic distance of 2 at sixty-seven markers. The TiP calculator calculates a 44.43-percent probability that the test-takers share a common ancestor in the last four generations, and an 84.11-percent probability that the test-takers share a common ancestor in the last eight generations. In fact, the two test-takers in this example share a common ancestor at six generations.
FTDNATiP provides percentage estimates that you and a Y-DNA match shared an ancestor within a certain number of generations.
Because the TiP calculation is based on individual mutation rates for specific markers, the same genetic distance can have slightly different TiP estimates.
A test-taker can also search a free public Y-STR database called Ysearch <www.ysearch.org>. The site was created and is maintained by Family Tree DNA, and it contains thousands of records from test-takers who tested in the past at companies other than Family Tree DNA. As such, Ysearch offers another opportunity for Y-STR test-takers to find men with similar Y-STR haplotypes.
A Y-DNA project is a collaborative effort to answer genealogical questions using the results of Y-DNA testing. A surname project, for example, brings together individuals with the same (or similar) surname(s), while a geographic project gathers individuals by location rather than by family or surname. Other projects bring individuals together based upon their haplogroup designation. Administrators who are responsible for organizing results, sharing information, and recruiting new members to the group run these DNA groups.
Family Tree DNA hosts more than eight thousand different DNA projects, including both mtDNA and Y-DNA projects. The Williams DNA Project <www.familytreedna.com/groups/williams-dna>, for example, has more than thirteen hundred members. Other projects may only have a few test-takers.
Finding a DNA project is usually very simple. Here are four places to begin your search:
DNA projects can potentially accomplish a number of goals for participants, including:
In addition to these benefits, you’ll have a financial incentive to joining a surname or geographic project even before ordering a Y-DNA test. Family Tree DNA offers a testing discount to every member of a DNA project.
Similar to mtDNA results, the results of a Y-DNA test can be used to examine genealogical questions, including confirming known lines, analyzing family mysteries, and potentially breaking through brick walls. Traditional documentary research can combine with the results of Y-DNA testing to make a powerful tool for genealogists.
Since Y-DNA is inherited paternally, it is very good at determining whether two people are related through their paternal lines. And unlike mtDNA, Y-DNA can estimate approximately how much time has passed since two people shared a common patrilineal ancestor. And unlike autosomal DNA (atDNA), Y-DNA is passed down to the next generation largely unchanged and does not recombine with other DNA. The Y chromosome analyzed in a living male is virtually identical to the Y chromosome in his paternal great-great-great-grandfather.
While providing numerous benefits, Y-DNA testing also has several important limitations when it is being applied to genealogical questions. For example, Y-DNA testing can only determine whether two people are paternally related on their direct patrilineal line. Further, a Y-DNA test can only reveal whether two men are paternally related somehow, but is unable to determine exactly how those two men are paternally related. For example, the men could have been brothers, father/son, first cousins, or a more distant relationship like fifth cousins.
It is also possible to use Y-DNA testing to determine whether you might be paternally related to an atDNA match. As we’ll learn later in the book, an atDNA match can be found on any of your ancestral lines, but it is difficult to identify the common ancestor shared with an atDNA match. If that atDNA match also shares your Y-DNA (or the Y-DNA of a paternal relative), then you can significantly narrow down which lines to search for a common ancestor.
As another example, adoptees often use Y-DNA testing to assist them in their search for their biological family. Finding a close Y-DNA match can potentially point the adoptee toward the biological father’s family, and can even provide a possible biological surname, which can be an enormous clue for adoptees.
An increasingly common use of Y-DNA is to recover an unknown biological surname. For an adopted male, for example, the Y-DNA retains a link to a biological family that paper records may not possess, or that might be locked behind privacy walls. Based on my experience with the program, roughly 30 percent of males who test their Y-DNA through the Adopted DNA Project <www.familytreedna.com/public/adopted> at Family Tree DNA are able to identify their likely biological surname through Y-DNA alone.
For example, assume an adoptee by the name of Riley Graham has done extensive research but has not found any accessible records that reveal his biological surname. In an attempt to connect with biological relatives, Riley takes a 67-marker test, and his results reveal an interesting pattern:
Riley shares all markers with Roger and Philip Davis, meaning he is closely related to these individuals on his patrilineal line. It is very likely, therefore, that his biological father, grandfather, or other recent ancestor had the Davis surname. Riley and Frederick Davis have a genetic distance of 1, so their relationship is potentially a little more distant. Roger and John Thomas have a genetic distance of 2. This could represent a non-paternal event. A non-paternal event can occur, for example, if a Thomas ancestor adopted a Davis child, if the wife of a Thomas ancestor had an affair with a Davis man, or if a Thomas male decided to change his surname to Davis.
Y-DNA testing will not always reveal the surname as it has in this example. Often, the individuals in the test-taker’s match list will be too distantly related to be definitive. For example, the results may show a match list with several or many different surnames. Alternatively, few people may be in the match list, or they may all be very distantly related. In that instance, the test-taker can wait for other men (potential new matches) to take Y-DNA tests, or can identify men who might be good candidates and ask if they are willing to undergo Y-DNA testing.
The Y chromosome is one of the two sex chromosomes. Only men possess a Y chromosome, and a father passes down his Y chromosome to only his sons. As a result of this unique inheritance pattern, Y-DNA is only used to examine a test-taker’s paternal line.
Y-DNA testing is done by either sequencing short regions of the Y chromosome (Y-STR testing) or through SNP testing (Y-SNP testing) of the Y chromosome.
The results of any Y-DNA test can be used to determine the paternal haplogroup, or ancient origins, of the paternal line back thousands of years. Y-STR tests estimate the paternal haplogroup, while Y-SNP tests definitively determine the paternal haplogroup.
The results of an Y-STR sequencing test can be used to fish for genetic cousins. Since the Y chromosomes mutates relatively rapidly and at a well-characterized rate, Y-STR testing is very good at finding random genetic matches in a testing company’s database and estimating how many generations have passed since two men shared a common paternal ancestor.
Y-DNA test results can be useful for examining specific genealogical questions, such as whether two people are or are not paternally related.
In the diagram below, a genealogist has identified two historical men, Philip and Joseph, as potential brothers based on well-researched paper-trail evidence. To determine whether the two men could have been brothers, the genealogist has traced descendants of Philip and Joseph and asked them to take a Y-STR test. Both descendants agreed, and the genealogist is now reviewing the results.
The results of the 67-marker Y-STR test taken by the two descendants, a brief excerpt of which is shown below, reveal that the two test-takers are identical at all sixty-seven markers:
Although Philip’s descendant and Joseph’s descendant have identical Y-DNA test results, this does not alone prove that Philip and Joseph were brothers. Just like mtDNA, Y-DNA cannot determine an exact relationship, and thus the results only provide additional support for the hypothesis that Philip and Joseph could have been brothers. They also could have been father/son, uncle/nephew, paternal male cousins, or a variety of other possible relationships, as long as they share a paternal line. Indeed, they could even be very distant paternal cousins. Still, it is feasible to explore the possibility that Philip and Joseph could be brothers, particularly in view of documentary evidence.
However, let’s assume that the results actually came back and indicated that they were not similar, or that they even belonged to completely different haplogroups. That would mean that at least one of the following scenarios is true: (1) Philip and Joseph were in fact not brothers or (2) somewhere in the patrilineal line between Philip and his purported Y-DNA descendant—or between Joseph and his purported Y-DNA descendant—a “break” in the line, such as an adoption, occurred.
As mentioned earlier in this chapter, a break in a Y-DNA line is known as misattributed parentage or a non-paternal event (NPE). NPEs occur at a rate of approximately 1 to 2 percent in the generation population, and can be due to a variety of factors such as adoption, name change, infidelity, and others. Although NPEs are rare, they should always be considered when reviewing Y-DNA test results.
As discussed in the previous chapter, skeletal remains thought to be of King Richard III were found in 2012 under a parking lot in Leicester, England. The thirty-two-year-old king was killed in the Battle of Bosworth Field and buried within the Greyfriars Friary Church in Leicester, England. However, the location of Richard’s grave was ultimately lost through the passage of time. DNA testing of the remains determined that the skeleton’s relatively rare mtDNA was identical or nearly identical to the mtDNA of two very distant descendants of King Richard III’s sister, Anne.
To further support the hypothesis that the skeletal remains were those of Richard III, the researchers wanted to compare the Y-DNA obtained from the skeleton to Y-DNA from some of Richard’s paternal relatives. Since Richard III had no children, genealogists had to go back to Richard’s great-great-grandfather, Edward III, and follow his descendants forward to find a candidate who would share Y-DNA with Richard III. The genealogists ultimately identified five living descendants who took Y-DNA tests (labeled A through E).
Y-SNP testing of individuals A through E revealed that four of them belonged to the Y-DNA haplogroup R1b-U152 (a single patrilineal group). However, one of the individuals belonged to haplogroup I-M170 and thus was not a patrilinear relative of the other four within the time span considered, indicating that a break had occurred within the last four generations. In contrast, the Y-DNA sequenced from the skeletal remains belonged to haplogroup G-P287, with a corresponding Y-STR haplotype. Thus, surprisingly, the Y-DNA of the two brother’s lines (John of Gaunt’s line and Edward of York’s line) does not match.
Overall, the evidence (such as the Y-DNA results and the results of the mtDNA test, mentioned in chapter 4) overwhelmingly concluded that the skeletal remains were indeed those of Richard III. The Y-DNA results also suggest there is a case of misattributed parentage somewhere between Richard III and individuals A through E. Because four of the test-takers had the same Y-DNA, the case of misattributed parentage is almost certainly at or before Henry Somerset. Nineteen generations separate Richard III and Henry Somerset, and, assuming a rate of NPEs of 1 to 2 percent per generation, the chance of misattributed parentage occurring in this number of generations is 16 percent.
