Chapter 7: Recombinant DNA and Genetic Engineering

Chapter 7

Recombinant DNA and Genetic Engineering

Deoxyribonucleic acid is the cell's database. Within the base sequence is all the information necessary to encode RNA and protein. A number of biological and chemical methods now give us the ability to isolate DNA molecules and to determine their base sequence. Once we have the DNA and know the sequence, many possibilities open up. We can identify mutations that cause disease, make a human vaccine in a bacterial cell, or alter a sequence and hence the protein it encodes. The knowledge of the entire base sequence (In Depth 5.2 on ) of the human genome, and of the genomes of many other organisms, such as bacteria that cause disease, is revolutionizing medicine and biology. In future years the power of genetic engineering is likely to impact ever more strongly on industry and on the way we live. This chapter describes some of the important methods involved in recombinant DNA technology at the heart of which is DNA cloning.

DNA Cloning

DNA cloning has had an enormous impact on our understanding of the information stored within cells. This is because the technology used in DNA cloning allows us to fragment large DNA molecules (e.g., a chromosome) into smaller ones and to separate these from each other. Cloning is a way to make many copies of selected DNA molecules and to store particular DNA sequences for later copying. It is very difficult to work with just one copy of a molecule of DNA: cloning provides the investigator with many copies of an identical DNA sequence that are then amenable to analysis.

Since all DNA molecules have very similar chemical properties, it is extremely difficult to purify individual species of DNA by classical biochemical techniques similar to those used successfully for the purification of proteins. However, we can use DNA cloning to help us to separate DNA molecules from each other. A clone is a population of cells that arose from one original cell and, in the absence of mutation, all members of a clone will be genetically identical. If a foreign gene or gene fragment is introduced into a cell and the cell then grows and divides repeatedly, many copies of the foreign gene can be produced, and the gene is then said to have been cloned. A DNA fragment can be cloned from any organism. The basic approach to cloning a gene is to take the genetic material from the cell of interest, which in the examples we will describe is a human cell, and to introduce this DNA into bacterial cells. Clones of bacteria are then generated, each of which contains and replicates one fragment of the human genetic material. The clones that contain the gene we are interested in are then identified and grown separately. We therefore use a biological approach to isolate DNA molecules rather than physical or chemical techniques.

Creating the Clone

How do we clone a human DNA sequence? The human genome has 3 × 109 base pairs of DNA, and with the exception of gametes (Chapter 18) and lymphocytes (Chapter 19) the DNA content of each cell is identical. However, each cell expresses only a fraction of its genes. Different types of cells express different sets of genes and thus their mRNA content is not the same. In addition, processed mRNA is shorter than its parent DNA sequence and contains no introns . Consequently, it is much easier to isolate a DNA sequence by starting with its mRNA. We therefore start the cloning process by isolating mRNA from the cells of interest. The mRNA is then copied into DNA by an enzyme called reverse transcriptase that is found in some viruses. As the newly synthesized DNA is complementary in sequence to the mRNA template, it is known as complementary DNA, or cDNA. The sample of cDNAs, produced from the mRNA, will represent the products of many different genes.

The way in which a cDNA molecule is synthesized from mRNA is shown in Figure 7.1. Most eukaryotic mRNA molecules have a string of As at their 3′ end, the poly-A tail . A short run of T residues can therefore be used to prime the synthesis of DNA from an mRNA template using reverse transcriptase. The resulting double-stranded molecule is a hybrid containing one strand of DNA and one of RNA. The RNA strand is removed by digestion with the enzyme ribonuclease H. This enzyme cleaves phosphodiester links in the RNA strand of the paired RNA-DNA complex, making a series of nicks down the length of the RNA. DNA polymerase is then added. This homes in on the nicks and then moves along replacing ribonucleotides with deoxyribonucleotides. Lastly, DNA ligase is used to reform any missing phosphodiester links. In this way a double-stranded DNA molecule is generated by the replacement of the RNA strand with a DNA strand. If the starting point had been mRNA isolated from liver cells, then a collection of cDNA molecules representative of all the mRNA molecules within the liver will have been produced. These DNA molecules now have to be introduced into bacteria.

Figure 7.1 Synthesis of a double-stranded DNA molecule.

Introduction of Foreign DNA Molecules into Bacteria

Cloning Vectors

To ensure the survival and propagation of foreign DNAs, they must be inserted into a vector that can replicate inside bacterial cells and be passed on to subsequent generations of the bacteria. The vectors used for cloning are derived from naturally occurring bacterial plasmids or bacteriophages. Plasmids are small circular DNA molecules found within bacteria. Each contains an origin of replication and thus can replicate independently of the bacterial chromosome and produce many copies of itself. Plasmids often carry genes that confer antibiotic resistance on the host bacterium. The advantage of this to the scientist is that bacteria containing the plasmid can be selected for in a population of other bacteria simply by applying the antibiotic. Those bacteria with the antibiotic resistance gene will survive, whereas those without it will die. Figure 7.2 shows the basic components of a typical plasmid cloning vector: an antibiotic resistance gene, a restriction endonuclease site (see next section) at which foreign DNA can be inserted, and an origin of replication so the plasmid can copy itself many times inside the bacterial cell.

Figure 7.2 A plasmid cloning vector.

Bacteriophages are viruses that infect bacteria and utilize the host cell's components for their own replication. The bacteriophage genome is, like a plasmid, circular, although many viruses use RNA rather than DNA as their genetic material. If human DNA is inserted into a bacteriophage, the bacteriophage will do the job of introducing it into a bacterium.

Joining Foreign DNAs to a Cloning Vector

Enzymes known as restriction endonucleases are used to insert foreign DNA into a cloning vector. Each restriction endonuclease recognizes a particular DNA sequence of (usually) 4 or 6 bp. The enzyme binds to this sequence and then cuts both strands of the double helix. Many restriction endonucleases have been isolated from bacteria. The names and recognition sequences of a few of the common ones are shown in Figure 7.3. Restriction endonuclease names are conventionally written in italics because they are derived from the Latin name for the bacterium in which the protein occurs.

Figure 7.3 Recognition sites of some common restriction endonucleases.

Example 7.1 The Cloning Vector pBluescript

The plasmid pBluescript is based on a naturally occurring plasmid that has been engineered to include several valuable features. pBluescript has an origin of replication, and the ampicillin resistance gene for selecting bacterial cells that have taken up the plasmid. The multiple cloning site (MCS) allows the scientist to cut the plasmid with the most appropriate restriction endonuclease for the task at hand. The MCS lies within the lac Z gene, which codes for the enzyme β-galactosidase . β-galactosidase converts a substrate known as X-gal to a bright blue product. Cells containing pBluescript without a foreign DNA in the MCS will produce blue colonies when grown on agar plates. However, when the lac Z gene is disrupted by insertion of a foreign DNA in the MCS, the cells containing the recombinant plasmids will grow to produce a colony with the normal color of white. This is because the function of the lac Z gene is destroyed and β-galactosidase is not produced. This is the basis of a test, called the blue/white assay, to identify colonies containing recombinant plasmids.

Another important feature of pBluescript is the presence of the bacteriophage T7 and T3 promoter sequences, which flank the MCS. These promoter sequences are used to transcribe mRNA from a cDNA cloned into one of the sites within the MCS. By selecting the promoter sequence, and adding the appropriate RNA polymerase (T3 or T7 RNA polymerase), either the sense or the antisense mRNA can be synthesized in a test tube. The mRNAs produced can then be used for a number of different techniques. For example, antisense RNAs produced in this way are used for in situ hybridization to detect cells producing a specific mRNA.

Some enzymes such as Bam H1, Eco R1, and Pst 1 make staggered cuts on each strand. The resultant DNA molecules are said to have sticky ends (Fig. 7.4) because such fragments can associate by complementary base pairing to any other fragment of DNA generated by the same enzyme. Other enzymes such as Sma H1 cleave the DNA smoothly to produce blunt ends (Fig. 7.4). DNA fragments produced in this way can be joined to any other blunt-ended fragment.

Figure 7.4 Restriction endonucleases generate two types of cut ends in double-stranded DNA.

Figure 7.5 illustrates how human DNA is inserted into a plasmid that contains a Bam H1 restriction endonuclease site. A short length of synthetic DNA (an oligonucleotide) that includes a Bam H1 recognition site is added to each end of the human DNA fragment. Both the human DNA and the cloning vector are cut with Bam H1. The cut ends are now complementary and will anneal together by hydrogen bonding. DNA ligase then catalyzes the formation of phosphodiester links between the vector and the human DNA. The resultant molecule is known as a recombinant plasmid. If our starting material was mRNA from a sample of liver, we would now have a collection of plasmids each carrying a cDNA from one of the genes that was being transcribed in this organ.

Figure 7.5 Generation of a recombinant plasmid.

Introduction of Recombinant Plasmids into Bacteria

Figure 7.6 summarizes how recombinant plasmids are introduced into bacteria such as Escherichia coli. Bacteria are first treated with concentrated calcium chloride to make the cell wall more permeable to DNA. DNA can now enter these cells, which are said to have been made competent. Cells that take up DNA in this way are said to be transformed. The transformation process is very inefficient, and only a small percentage of cells actually take up the recombinant molecules. This means that it is extremely unlikely that any one bacterium has taken up two plasmids. The presence of an antibiotic resistance gene in the cloning vector makes it possible to select those bacteria that have taken up a molecule of foreign DNA, since only the transformed cells can survive in the presence of the antibiotic. The collection of bacterial colonies produced after this selection process is a clone library. All the cells of a single colony harbor identical recombinant molecules that began as one mRNA molecule in the original cell sample. Other colonies in the same clone library contain plasmids carrying different DNA inserts. Isolating individual bacterial colonies will produce different clones of foreign DNA. In the example we have described, where the starting DNA material used to produce these clones was a population of cDNA molecules, the collection of clones is called a cDNA library.

Figure 7.6 Introduction of recombinant plasmids into bacteria.

Selection of cDNA Clones

Having constructed a cDNA library—which may contain many thousands of different clones—the next step is to identify the clones that contain the cDNA of interest. There are many ingenious ways of doing this. We will describe two ways of selecting cDNA clones from a library. One method simply detects the presence of the foreign DNA attached to the plasmid vector, and the second detects the protein encoded for by the foreign DNA. We call the process of selecting specific clones “screening the library.”

Preparation of the cDNA Library for Screening

Bacterial colonies are plated onto agar plates, and the colonies are replica-plated onto a nylon membrane, which is then treated with detergent to burst (or lyse) the bound cells (Fig. 7.7). If the clone is to be selected by virtue of its DNA sequence, the nylon membrane is processed with sodium hydroxide. This is necessary to break all hydrogen bonds between the DNA strands bound to the nylon membrane and ensures that the DNA is single-stranded. The processed nylon membrane is an exact replica of the DNA contained within each bacterial colony on the agar plate. If the clone is to be selected from the library by detecting the protein encoded by the foreign DNA, then colonies are again replica-plated on to a nylon membrane. This time, however, the nylon membrane is processed to produce an exact copy of the proteins synthesized by each bacterial colony.

Figure 7.7 A membrane lift takes images of DNA and protein from colonies.

Oligonucleotide Probes for cDNA Clones

If some of the amino acid sequence is known for the protein whose cDNA is to be cloned, an oligonucleotide can be synthesized in vitro (i.e., in a machine rather than in a cell) that has a sequence complementary to one of the strands of the cDNA. The first step is to use the genetic code to predict all possible DNA sequences that could code for a short stretch of amino acids within the protein. This strategy is shown in Figure 7.8. The sequence—met gln lys phe asn—can be coded for by 16 possible sequences, because of the degeneracy of the genetic code . All 16 oligonucleotide sequences are synthesized. One of the 16 sequences will be complementary to the cDNA we want to select from the library. The oligonucleotides are tagged with a radioactive phosphate group (32P) at their 5′ ends using the enzyme polynucleotide kinase (PNK) and the substrate [γ − 32P]ATP, that is, ATP whose γ phosphate is the radioactive isotope 32P. PNK removes the 5′-phosphate group from each oligonucleotide, leaving a 5′-hydroxyl group. The enzyme then transfers the γ(32P) phosphate group of [γ − 32P]ATP to the 5′-hydroxyl.

Figure 7.8 Use of a radioactive oligonucleotide probe to select a cDNA clone.

The nylon membrane to which the library DNA is attached is incubated together with the mixture of radiolabeled oligonucleotides. This process is called hybridization, a word used whenever two nucleic acid strands associate together by hydrogen bonding. In this case the oligonucleotide complementary in sequence to the clone we want to select will hydrogen bond to the single-stranded DNA on the nylon membrane. Once hybridization is complete, excess oligonucleotide is washed from the nylon membrane, which is now covered with a sheet of X-ray film and placed in a light-tight cassette. The radioactivity in the oligonucleotide will darken the silver grains on the X-ray film—a process known as autoradiography. A positive clone will show up as a black spot on the film. Superimposing the X-ray film back onto the original bacterial plate will identify the living bacterial colony that contains the desired foreign DNA clone.

Antibody Probes for cDNA Clones

This method makes use of specific antibodies to detect bacteria expressing the protein product of the DNA to be cloned. For this to work, the foreign DNA must be expressed in the bacterial cells; that is to say, its information must be copied first into mRNA and then into protein. To ensure efficient expression, the plasmid vector contains a bacterial promoter sequence that is used to control transcription of foreign DNA. Such cloning vectors are known as expression vectors. The promoter of the lac operon is commonly used in this way. The clone library is plated onto agar plates containing an inducer of the lac operon such as IPTG to ensure that lots of mRNA and in turn lots of protein is synthesized. Figure 7.9 shows how an antibody, linked to an enzyme (usually alkaline phosphatase), can detect a positive clone by generating a colored product. The pattern of colored spots on the nylon membrane is used to identify the bacterial clones of interest on the original agar plate.

Figure 7.9 Use of an antibody probe to select a cDNA clone.

Genomic DNA Clones

The approach described in the previous section permits the isolation of cDNA clones. Complementary DNA clones have many important uses, some of which are described below. However, as a cDNA is a copy of mRNA only, when we want to isolate a gene to investigate its structure and function, we need to create genomic DNA clones. Genes contain exons and introns and have regulatory sequences at their 5′ and 3′ ends and are therefore much larger than cDNAs. The vectors used to clone genes must therefore be able to hold long stretches of DNA. Plasmids used for cDNA cloning cannot do this. A selection of vectors used to clone genes is shown in Table 7.1. Vectors such as the P1 artificial chromosomes (PACs)—based on the bacteriophage P1—can hold about 150,000 bp of DNA. Vectors called BACs (bacterial artificial chromosome) can hold up to 300,000 bp. PACs and BACs have been used very successfully in the Human Genome Project and in the sequencing of the genomes of other organisms such as the mouse . A yeast artificial chromosome (YAC) can hold between 200,000 and 600,000 base pairs of foreign DNA. The choice of genomic vector is governed by the size of DNA the scientist needs to clone. PAC, BAC and YAC vectors are needed if an entire gene sequence is to be represented in a single clone. They contain all the sequences needed to produce a minichromosome in the appropriate cell type: PACs and BACs in bacterial cells, and YACs to replicate foreign sequences in a yeast cell. The YAC vector therefore contains sequences that will allow the DNA to be processed by the host yeast cell as if it were a normal chromosome and to allow replication alongside the other chromosomes in the cell. Thus a YAC vector has sequences that specify the yeast centromere , telomeres (the ends of the new chromosome), and the yeast origin of replication. A YAC vector also contains selectable marker genes so that only those cells that have been transformed by a correctly constructed YAC chromosome will survive.

Table 7.1 Vectors Used for Cloning Genomic DNA

Genomic DNA Cloning Vector	Size of Insert (kb)
Bacteriophage	9–23
Cosmid	30–44
PAC (P1 artificial chromosome)	130–150
BAC (bacterial artificial chromosome)	Up to 300
YAC (yeast artificial chromosome)	200–600

Example 7.2 Cloning a Receptor Protein cDNA

Glutamate is one of the most important transmitters in the brain. The gene coding for the ionotropic glutamate receptor, the protein on the surface of nerve cells that, upon binding glutamate, allows an influx of sodium ions , remained uncloned for a number of years. Success came with the use of a very clever cloning strategy, based on the function of the receptor. mRNA was isolated from brain cells and used as the template for the production of cDNA molecules. These were inserted into a plasmid expression vector. Following the introduction of these cDNAs into bacteria, a cDNA library representative of all the mRNAs in the brain was produced. The many thousands of cDNA clones in the library were then divided into pools. Each of the many pools was then injected into a frog egg (Xenopus oocyte), which transcribed the cDNAs into RNA and translated the RNA into protein. To see which of the oocytes had been injected with the cDNA for the glutamate receptor, these cells were whole-cell patch clamped . Glutamate was applied to the oocytes, and the oocyte whose injected pool had included the cDNA for the glutamate receptor responded with an inward current of sodium ions indicating the presence of glutamate receptors in the plasma membrane.

The pool of cDNAs giving this response was further divided into smaller pools. Each of these was rescreened for the presence of glutamate receptor activity. This was followed by several rounds of rescreening. For each round a further subdivision was made of the cDNAs into pools containing fewer and fewer cDNA molecules. Eventually each pool contained only a single cDNA so that the cDNA for the glutamate receptor could be identified. A number of other receptors have now been isolated using the same strategy in which a functional assay is used to identify the cDNA encoding the receptor.

To generate the large DNA fragments needed for genomic cloning, the chromosomal DNA is incubated with a restriction endonuclease for a very short time. Not all the recognition sites for that enzyme are cleaved, and large fragments of DNA are hence produced by what is called “partial digestion.” Genomic DNA fragments are joined to genomic cloning vectors in the same way we join cDNAs to cDNA cloning vectors. In the example shown in Figure 7.10, human DNA has been introduced into the genome of a bacteriophage known as lambda (λ). This particular vector can accommodate up to 23,000 bp of foreign DNA in its genome. Bacteria are then infected, generating a collection of bacteria called a genomic DNA library.

Figure 7.10 Generation and selection of genomic DNA clones.

To select the genomic DNA sequence of interest, the library is plated onto a layer (or lawn) of cultured bacteria so that many copies of the recombinant bacteriophage can be produced. A single λ bacteriophage infects a single E. coli. The recombinant bacteriophages then multiply inside the host cells. The cells die and lyse, and the bacteriophages spread to the surrounding layer of bacteria and infect them. These cells lyse, in turn, and the process is repeated. The dead cells give rise to a clear area on the bacterial lawn called a plaque. Each plaque contains many copies of a recombinant bacteriophage that can be transferred to a nylon membrane (Fig. 7.10). Specific DNA clones are selected by incubating the nylon membrane with a radiolabeled cDNA probe complementary to the genomic sequence being searched for. This produces a radioactive area on the nylon membrane that is identified by autoradiography. The use of a cDNA sequence as a gene probe makes the task of isolating the corresponding genomic sequence much easier.

A radioactive cDNA probe can be synthesized using the method called random priming. The cDNA clone is heated so that the two strands will separate. Each strand will act as the template for the synthesis of a new DNA strand. A mixture of random hexamers, six nucleotide sequences, containing all possible combinations of the four bases (A, T, C, G) is added to the denatured cDNA along with DNA polymerase and the four deoxynucleotides dATP, dTTP, dCTP, and dGTP. The hexamers will hydrogen bond (anneal) to their corresponding sequences on the cDNA templates and prime the synthesis of new DNA strands. If, for example, radiolabeled [α − 32P]dATP is included in the reaction, the newly synthesized DNA strands will be radioactive.

Uses of DNA Clones

The following techniques need large amounts of identical DNA and therefore can only be performed if one has cloned the gene and can therefore grow up the bacteria containing it in large numbers.

DNA Sequencing

The ability to determine the order of the bases within a DNA molecule has been one of the greatest technical contributions to molecular biology. DNA is made by the polymerization of the four deoxynucleotides dATP, dGTP, dCTP, and dTTP. These are joined together when DNA polymerase catalyzes the formation of a phosphodiester link between a free 3′-hydroxyl on the deoxyribose sugar moiety of one nucleotide and a free 5′-phosphate group on the sugar residue of a second nucleotide. However, the artificial dideoxynucleotides ddATP, ddGTP, ddCTP, and ddTTP have no 3′-hydroxyl on their sugar residue (Fig. 7.11), and so if they are incorporated into a growing DNA chain, synthesis will stop. This is the basis of the dideoxy chain termination DNA sequencing technique devised by Frederick Sanger, for which he was awarded a Nobel prize in 1980.

Figure 7.11 General structure of a dideoxynucleotide.

This technique is illustrated in Figure 7.12. A cloned piece of DNA of unknown sequence is first joined to a short oligonucleotide whose sequence is known. The DNA is then made single-stranded so that it can act as the template for the synthesis of a new DNA strand. All DNA synthesis requires a primer ; in this case a primer is provided that is complementary in sequence to the oligonucleotide attached to the template DNA. Four separate mixtures are prepared. Each contains the DNA template, the primer (which has been radiolabeled), DNA polymerase, and the four deoxynucleotides. The mixtures differ in that each also contains a low concentration of one of the four dideoxynucleotides ddATP, ddGTP, ddCTP, or ddTTP. When a molecule of dideoxynucleotide is joined to the newly synthesized chain, DNA synthesis will stop.

Figure 7.12 DNA sequencing by the dideoxy chain termination method.

Let us follow what happens in the tube containing ddTTP. The first base that DNA polymerase encounters in the DNA template to be sequenced is an A. Since the tube contains much more dTTP than ddTTP, DNA polymerase will add a dTTP to most of the primer molecules. However, a small fraction of the primers will have a ddTTP added to them instead of dTTP since DNA polymerase can use either nucleotide as a substrate. The next base encountered is a G. DNA polymerase is unable to attach dCTP to the ddTTP since there is no OH group on the 3′ carbon of the sugar, and so DNA synthesis is terminated. The majority of strands, however, had a dTTP added, and for these DNA polymerase can proceed, building the growing strand. No problems are encountered with the next six bases. However, the eighth base in the template strand is another A, and once again a small fraction of the growing strands will have ddTTP added instead of dTTP. In the same way as before, these strands can grow no further. This process will be repeated each time an A occurs on the template strand. When the reaction is over, the tube will contain a mixture of DNA fragments of different length, each of which ends in a ddTTP. Similarly, each of the other three tubes will contain a mixture of DNA chains of different length, each of which ends in either ddCTP, ddATP, or ddGTP.

To determine the sequence of the newly synthesized chains, each of the four samples is loaded onto a polyacrylamide gel. The monomeric form, acrylamide, is poured into a mold. A solid but porous gel forms as the acrylamide polymerizes. The shape of the mold is such that wells are formed at the top of the gel into which the samples can be loaded. The samples are then subjected to electrophoresis, that is, a voltage is applied across the gel and the DNA strands move, with the smallest ones moving the quickest. The polyacrylamide gel used for DNA sequencing has a resolving power of one nucleotide. This is an important feature, because it is the ability to separate out strands terminated at each nucleotide along a strand of DNA that makes it possible to read a DNA sequence and determine the order of the As, Ts, Cs and Gs. Because the primer used was radiolabeled, all the new DNA chains will carry a radioactive tag so that, after electrophoresis, the pattern of DNA fragments on the gel can be detected by autoradiography. Each terminated reaction will show up as a black band on the X-ray film. The smallest DNA molecules are that fraction in the tube containing ddTTP whose growth was blocked after the first base, T. These move farthest and produce the band at the bottom of the T lane. DNA molecules one nucleotide larger were produced in the tube containing ddCTP—their growth was blocked after the second base, C. These move almost as far, but not quite, producing the band at the bottom of the C lane. Reading bands up from the bottom of the gel therefore tells us the sequence in which bases were added to the unknown strand: T, C, and so on. Because the new chain is complementary in sequence to its template strand, the sequence of the template strand can be inferred.

The Human Genome Project required the process of DNA sequencing to be automated. Instead of using radioactivity and one reaction tube for each dideoxynucleotide, we now use dideoxynucleotides tagged with fluorescent dyes. Each of the four dideoxynucleotides ddATP, ddGTP, ddCTP, and ddTTP is tagged with a different fluorescent dye. This means that all four of the termination reactions can be carried out in a single reaction tube and loaded into the same well on the polyacrylamide gel. As the reaction product drips from the bottom of the gel, the fluorescence intensity of each of the four colors corresponding to the four dideoxynucleotides is monitored, and this information is transferred straight to a computer where the data are analyzed. An example of a DNA trace produced using fluorescently tagged dideoxynucleotides is shown in Figure 7.13. Each peak represents a terminated DNA product, so by reading the order of the peaks, the DNA sequence is determined. In this example G is yellow, A is green, T is red, and C is blue. To determine the base sequence of the entire human genome, the DNA was cut by partial restriction endonuclease digestion to give large fragments of about 150,000 bp. These were cloned into a vector such as PAC (Table 7.1). The aim was to create a library of clones that overlapped one another. Each clone was sequenced, as described above, and their base sequences compared. Because the clones overlapped, it was possible, by comparing their sequences, to line up the position of each clone with respect to its neighbors. This required the development of sophisticated computer programs, and the creation of a large database of information to order the 3 × 109 base pairs that comprise the human genome. Examples of the databases constructed to handle the information from the human genome project and many other genome projects that are now underway can be viewed at the Sanger Institute website (www.sanger.ac.uk/) and that of the National Institutes of Health (www.ncbi.nlm.nih.gov/).

Figure 7.13 Typical output of an automated DNA sequencer.

Southern Blotting

In 1975 Ed Southern developed an ingenious technique, now known as Southern blotting, which can be used to detect specific genes (Fig. 7.14). Genomic DNA is isolated and digested with one or more restriction endonucleases. The resultant fragments are separated according to size by agarose gel electrophoresis. The gel is soaked in alkali to break hydrogen bonds between the two DNA strands and then transferred to a nylon membrane. This produces an exact replica of the pattern of DNA fragments in the agarose gel. The nylon membrane is incubated with a cloned DNA fragment tagged with a radioactive label. The gene probe is heated before being adding to the nylon membrane to make it single-stranded so it will base pair, or hybridize, to its complementary sequences on the nylon membrane. As the gene probe is radiolabeled, the sequences to which it has hybridized can be detected by autoradiography.

Figure 7.14 The technique of Southern blotting.

Mutations that change the pattern of DNA fragments—for instance, by altering a restriction endonuclease recognition site or deleting a large section of the gene—can easily be detected by Southern blotting. This technique is therefore useful in determining whether an individual carries a certain genetic defect. All that is needed is a small DNA sample from white blood cells or, in the case of a fetus, from the amniotic fluid in which it is bathed, or by removing a small amount of tissue from the chorion villus that surrounds the fetus in the early stages of pregnancy.

Forensic laboratories use Southern blotting to generate DNA fingerprints from samples of blood or semen left at the scene of a crime. A DNA fingerprint is a person-specific Southern blot. The gene probe used in the test is a sequence that is repeated very many times within the human genome—a microsatellite sequence . Everyone carries a different number of these repeated sequences, and because they lie adjacent to each other on the chromosome they are called VNTRs (variable number tandem repeats). When genomic DNA is digested with a restriction endonuclease and then analyzed by Southern blotting, a DNA pattern of its VNTRs is produced. Unless they are identical twins, it is extremely unlikely that two individuals will have the same DNA fingerprint profile. It has been estimated that if eight restriction endonucleases are used, the probability of two people who are not identical twins generating the same pattern is one in 1030.

A special type of Southern blot, called a zoo blot, can be used to reveal genes that are similar in different species. Such genes, which have been conserved through evolution, are likely to code for crucial proteins. A probe generated from a genomic DNA library is used to probe genomic DNA from many different species. A probe that hybridizes with DNA from a number of species is likely to represent all or part of such a conserved gene.

In situ Hybridization

It is possible, using the technique of in situ hybridization, to identify individual cells expressing a particular mRNA. To do this we need to synthesize an antisense RNA molecule—an RNA that is complementary in sequence to the mRNA of interest. In a test tube, the appropriate strand of the cloned cDNA is copied into the antisense RNA using RNA polymerase. The RNA is then labeled with a modified nucleotide that can subsequently be detected using an antibody and a color reaction. The cDNA must first be cloned into an expression vector that contains a promoter sequence to which RNA polymerase can bind. A thin tissue section, attached to a glass microscope slide, is incubated with the antisense RNA. The antisense RNA will hybridize, in the cell, to its complementary mRNA partner. Excess antisense RNA is washed off the slide, leaving only the hybridized probe. The color reaction is now carried out so that the cells expressing the mRNA of interest can be identified by bright-field microscopy .

Medical Relevance 7.1 Microarrays and Cancer Classification

Microarrays or gene chips are tiny glass wafers to which cloned DNAs are attached. The principle of microarray technology is to isolate mRNA from a particular cell and to hybridize this to the DNAs on the chip. Because the mRNAs are tagged with a fluorescent dye, the DNAs to which they hybridize on the chip can be detected. Excess mRNA is removed, and fluorescent areas are viewed using a special scanner and microscope. Computer algorithms have been written to analyze the hybridization patterns seen for a particular microarray. The number and type of DNAs used to make a microarray is dependent on the question to be answered.

One of the spinoffs of the Human Genome Project is to identify sets of genes involved in disease. Microarrays are being used to type the mRNAs produced by different cancers in the hope that this will lead to better diagnosis and therefore better treatment. Leukemia, a cancer affecting the blood, is not a single type of disease. Microarray analysis is helping to classify different types of leukemia more precisely by cataloging the mRNAs expressed in different patients. Preliminary studies are encouraging. A microarray of 6817 cDNAs was used to compare the blood mRNAs from patients with acute lymphoblastic leukemias or acute myeloid leukemias. The mRNAs of each patient were passed over the microarray and complementary sequences hybridized. Fifty cDNA/mRNA hybrids were found that could be used to refine the classification of lymphoblastic and myeloid leukemias. In addition, the patterns allowed the classification of lymphoblastic leukemias into T-cell or B-cell classes (Chapter 19). This separation of lymphoblastic leukemias into two classes is an important distinction when it comes to deciding on the best treatment for a patient. As more patients with leukemia are investigated using microarrays, it should be possible to design smaller chips, with fewer cDNAs, but with greater prognosis value.

A recent study has shown that the fate of women with breast cancer can be predicted by microarray analysis of their cancer tissue. Several genes were shown to be important for this prediction. If the women had a certain gene expression pattern, then the disease was likely to recur within a five-year period. However, if the gene pattern was of a second type, the cancer almost never returned. Women that fall into this second class also show no additional benefit from chemotherapy or radiotherapy. Microarray analysis not only offers a survival prognosis for women with breast cancer but has also shown that unpleasant treatment for the disease is unnecessary for those possessing the second type of gene pattern.

Northern Blotting

Figure 7.15A shows a blotting technique that can determine the size of an mRNA and tell us about its expression patterns. RNA is denatured by heating to remove any intramolecular double-stranded regions and then electrophoresed on a denaturing agarose gel. The RNA is transferred to a nylon membrane (as described in Figure 7.14 for the transfer of DNA). The nylon membrane is incubated with a radiolabeled, single-stranded cDNA probe, or an antisense RNA probe . Following hybridization, excess probe is washed off and the nylon membrane exposed to X-ray film. The mRNA is visualized on the autoradiogram because it hybridized to the radioactive probe. By analogy with Southern blotting, this technique is called northern blotting (Table 7.2). Figure 7.15B shows a northern blot for a cytochrome P450 mRNA known as CYP2B1. The gene for this protein is activated in the liver by the barbiturate phenobarbital and hence a lot of CYP2B1 mRNA is made.

Figure 7.15 (A) The technique of northern blotting. (B) A northern blot reveals that transcription of the CYP2B1 gene is increased in animals given phenobarbital.

Table 7.2 Blotting Techniques

Production of Mammalian Proteins in Bacteria

The large-scale production of proteins using cDNA-based expression systems has wide applications for medicine and industry. It is increasingly being used to produce polypeptide-based drugs, vaccines, and antibodies. Such protein products are called recombinant because they are produced from a recombinant plasmid. For a mammalian protein to be synthesized in bacteria its cDNA must be cloned into an expression vector (as described on ). Insulin was the first human protein to be expressed from a plasmid introduced into bacterial cells and has now largely replaced insulin from pigs and cattle for the treatment of diabetes. Other products of recombinant DNA technology include growth hormone and factor VIII, a protein used in the treatment of the blood clotting disorder hemophilia. Factor VIII was previously isolated from donor human blood. However, because of the danger of infection from viruses such as HIV, it is much safer to treat hemophiliacs with recombinant factor VIII. It should, in theory, be possible to express any human protein via its cDNA.

Protein Engineering

The ability to change the amino acid sequence of a protein by altering the sequence of its cDNA is known as protein engineering. This is achieved through the use of a technique known as site-directed mutagenesis. A new cDNA is created that is identical to the natural one except for changes designed into it by the scientist. This DNA can then be used to generate protein in bacteria, yeast, or other eukaryotic cell lines.

The first use of protein engineering is to study the protein itself. A comparison of the catalytic properties of the normal and mutated form of an enzyme helps to identify amino acid residues important for substrate and cofactor binding sites (Chapter 11). This technique was also used to identify the particular charged amino acid residues responsible for the selectivity of ion channels . Now scientists are using protein engineering to generate new proteins as tools, not only for scientific research but for wider medical and industrial purposes.

Subtilisin is a protease and is one of the enzymes used in biological washing powder. The natural source of this enzyme is Bacillus subtilis, an organism that grows on pig feces. To produce, from this source, the 6000 tons of subtilisin used per year by the soap powder industry is a difficult and presumably unpleasant task. The cDNA for subtilisin has been isolated and is now used by industry to synthesize the protein on a large-scale in E. coli. The wild-type (natural) form of subtilisin is, however, prone to oxidation because of a methionine present at position 222 in the protein. Its susceptibility to oxidation makes it an unsuitable enzyme for a washing powder that must have a long shelf life and be robust enough to withstand the rigors of a washing machine with all its temperature cycles. Scientists therefore changed the codon for methionine (AUG) to the codon for alanine (GCG). When the modified cDNA was expressed in E. coli, the resulting enzyme was found to be active and not susceptible to oxidation. This was excellent news for the makers of soap powder. However, it is always necessary to check the kinetic parameters of a new protein produced from a modified cDNA. For subtilisin (met222) the KM is 1.4 × 10−4 moles liter−1 while for subtilisin (ala222) the KM is 7.3 × 10−4 moles liter−1. This means that at micromolar concentrations of dirt the modified enzyme will bind less dirt than the wild-type one, but the dirt concentrations caked onto our clothes are well above micromolar. The turnover number, kcat , is 50 s−1 for subtilisin (met222) and 40 s−1 for subtilisin (ala222): The mutant enzyme is slightly slower, but not by much. By changing a met to an ala, a new enzyme has been produced that can do a reasonable job and is stable during storage and in our washing machines.

Green fluorescent protein is found naturally in certain jellyfish. Protein engineering has now created a palette of proteins with different colors. However, the great advantage of these proteins to biologists is that chimeric proteins (proteins composed of two parts, each derived from a different protein) incorporating a fluorescent protein are intrinsically fluorescent. This means that our protein of interest can be imaged inside a living cell using a fluorescence microscope (In Depth 1.1 on . The fluorescent part of the chimeric protein tells us exactly where our protein is targeted in the cell and if this location changes in response to signals.

Figure 7.16 illustrates how this approach can be used to determine what concentration of glucocorticoid drug is required to cause the glucocorticoid receptor to move to the nucleus. The plasmid, like many plasmids designed for convenience of use, contains a multiple cloning site (MCS), sometimes called a polylinker, which is a stretch of DNA that contains several restriction endonuclease recognition sites. A convenient restriction endonuclease is used to cut the plasmid (which already contains the sequence that codes for green fluorescent protein) and the cDNA for the glucocorticoid receptor is inserted. The plasmid also contains a promoter sequence, derived from a virus, that will drive the expression of the DNA into mRNA in mammalian cells that have been infected with the plasmid (or transfected). The plasmid is grown up in bacteria and then used to transfect mammalian cells. The chimeric protein, part green fluorescent protein and part glucocorticoid receptor, is synthesized in the cells from the mRNA. In the absence of glucocorticoid the protein, and therefore the green fluorescence, is in the cytosol. When enough glucocorticoid is added, it binds to the chimeric protein, which then moves rapidly to the nucleus.

Figure 7.16 A chimera of green fluorescent protein and the glucocorticoid receptor reveals its location in living cells.

Polymerase Chain Reaction

The polymerase chain reaction (PCR) is a technique that has revolutionized recombinant DNA technology. It can amplify DNA from as little material as a single cell and from very old tissue such as that isolated from Egyptian mummies, a frozen mammoth, and insects trapped in ancient amber. A simple mouth swab can yield enough cheek cell DNA to determine carriers of a particular recessive genetic disorder. PCR is used to amplify DNA from fetal cells or from small amounts of tissue found at the scene of a crime. The tool that makes PCR possible is a thermostable DNA polymerase, an enzyme that can function at extremely high temperatures that would denature most enzymes. Thermostable DNA polymerases are isolated from prokaryotes that live in extremely hot deep-sea volcanic environments.

Figure 7.17 shows how PCR uses a thermostable DNA polymerase and two short oligonucleotide DNA sequences called primers. Each primer is complementary in sequence to a short length of one of the two strands of DNA to be amplified. The DNA duplex is heated to 90°C to separate the two strands (step 1). The mixture is cooled to 60°C to allow the primers to anneal to their complementary sequences (step 2). At 72°C the primers direct the thermostable DNA polymerase to copy each of the template strands (step 3). These three steps, which together constitute one cycle of the PCR, produce twice the number of original templates. The process of template denaturation, primer annealing, and DNA synthesis is repeated many times in a tube in an automated heater block to yield many thousands of copies of the original target sequence.

Figure 7.17 Amplification of a DNA sequence using the polymerase chain reaction.

Identifying the Gene Responsible for a Disease

Until recently, the starting point for an identification of the gene responsible for a particular inherited disease was a pattern of inheritance in particular families plus a knowledge of the tissues affected. It is very difficult to find the gene responsible for a disease when the identity of the normal protein is unknown. Very often, the first clue is the identification of other genes that are inherited along with the malfunctioning gene and that are therefore likely to lie close on the same chromosome (this is linkage, . In the past, chromosome walking was then used to identify the disease gene. This is a slow and tedious process that involves isolating a series of overlapping clones from a genomic clone library. One starts by isolating a single clone and then uses this as a probe to find the next clone along the chromosome. The second clone is used to find the third, and this is used to find a fourth clone, and so on. Each successive clone is tested to find out if it might include all or part of the gene of interest (e.g., by using northern blotting to see if the gene is expressed in a tissue known to be affected in the disease). Once a candidate gene is identified, one can find out if it was the gene of interest by sequencing it in unaffected individuals and in disease sufferers; if it is the disease gene, its sequence will be different in the affected people. With the publication of the entire human genome, chromosome walking to generate a series of overlapping clones for testing is unnecessary, but identifying the gene that is responsible for a particular inherited condition is even now a time-consuming task.

Reverse Genetics

Because beginning with an inherited defect in function and working toward identification of a gene is even today a time-consuming task, more and more scientists are now working the other way: they take a gene with a known sequence but unknown function and deduce its role. Since we know the complete genome of a number of species, we can sit at a computer and identify genes that look interesting—for example, because their sequence is similar to a gene of known function. The gene of interest can be mutated and reinserted into cells or organisms, and the cells or organisms tested for any altered function. This approach is called reverse genetics.

Transgenic and Knockout Mice

A transgenic animal is produced by introducing a foreign gene into the nucleus of a fertilized egg (Fig. 7.18A). The egg is then implanted into a foster mother and the offspring are tested to determine whether they carry the foreign gene. If they do, a transgenic animal has been produced. The first transgenic mice ever made were used to identify an enhancer sequence that activates the metallothionein gene when an animal is exposed to metal ions in its diet. The 5′ flanking sequence of the metallothionein gene was fused to the rat growth hormone gene (Fig. 7.18B). This DNA construct, the transgene, was injected into fertilized eggs. When the mice were a few weeks old, they were given drinking water containing zinc. Mice carrying the transgene grew to twice the size of their litter mates because the metallothionein enhancer sequence, stimulated by zinc, had increased growth hormone production.

Figure 7.18 (A) Transgenic mouse carrying a foreign gene. (B) The metallothionein gene contains a heavy-metal ion enhancer sequence. The + mice carry the transgene while littermates without the transgene are indicated by −.

Transgenic farm animals—such as sheep synthesizing human factor VIII in their milk—have been created. This is an alternative to producing human proteins in bacteria.

IN DEPTH 7.1 GENETICALLY MODIFIED (GM) PLANTS—CAN THEY HELP TO FEED THE WORLD?

The arguments about the value of GM crops and the damage they cause the environment will continue for a long time. These have largely concerned plants that produce insecticide and plants that are resistant to herbicide. Almost unnoticed in the maelstrom of claim and counterclaim has been the use of genetic engineering to produce nutritionally enhanced crops. Rice is a staple food in many countries but lacks many vital nutrients. The World Health Organization estimates that 250,000 to 500,000 children go blind each year because of vitamin A deficiency and millions of children in the developing world suffer from a weakened immune system because their diets do not contain sufficient quantities of this vitamin. In an attempt to overcome this severe nutritional deficiency, a group of Swiss scientists have engineered the rice endosperm (the part we eat) to produce provitamin A (beta-carotene). This is converted in the body to vitamin A. Rice does produce beta-carotene in the green tissue but some of the genes needed to produce this chemical are switched off in the endosperm. The Swiss scientists inserted two of the genes that had been switched off in the endosperm back into the rice genome. The genetically modified rice plant with the inserted genes produces an endosperm that is golden in colour because beta-carotene is produced. Hence the name golden rice for this crop. The more yellow the crop, the more beta-carotene is produced.

The creators of golden rice have donated their technology to the developing world and the paperwork necessary to allow its use in Bangladesh, India, Indonesia, and the Philippines is at the time of writing being funded by the Rockefeller Foundation in New York. The hope is that the required daily dose of beta-carotene will be delivered in about 100–200g of rice, which corresponds to the average daily rice consumption in countries where this crop is a major part of the diet.

Genetically modified mice are increasingly being used to prove a protein's function. To do this the gene sequence is modified so that protein function is knocked out. In this case a knockout mouse is produced. This is done by either inserting a piece of foreign DNA into the gene, or by deleting the gene from the mouse genome. The consequences of the protein's absence are then established. Figure 7.19 describes the method called insertional mutagenesis for knocking out a gene's function. The first step is to isolate a genomic clone containing the gene to be knocked out. A marker gene, such as the drug resistance gene neo (for resistance to the antibiotic G418, an analogue of the antibiotic neomycin), is then inserted into the genomic clone, usually in exon 2 of the gene. This means that the normal, functional product of the gene cannot be synthesized. This modified piece of DNA is then introduced into embryonic stem (ES) cells. These are cells derived from the inner mass of a mouse blastocyst—that is, a very early embryo. The mouse strain from which the ES cells are derived has a butterscotch coat color. Homologous recombination inside the embryonic stem cells will replace the normal gene with the modified piece of DNA carried on the plasmid. Cells in which this rare event happens will survive when grown on G418 while embryonic stem cells not containing the antibiotic-resistance gene will die. The genetically modified embryonic stem cells are inserted into the blastocyst cavity of a black mouse and the blastocyst implanted into a foster mother. Knockout mice will be chimeric and have a mixed color coat because the cells derived from the genetically modified embryonic stem cells will give a butterscotch-color coat while the cells from the blastocyst will give a black-color coat. Subsequent breeding of the chimeric mouse to mice with a black-coat color will produce a pure black mouse with both copies of the gene nonfunctional. The effect of knocking out the gene can then be analyzed.

Figure 7.19 Knockout mice. (A) A region of the targeting vector is incorporated into the genome of embryonic stem cells by homologous recombination. (B) Genetically modified embryonic stem cells are injected into a blastocyst, which is implanted into a foster mother.

Ethics of DNA Testing for Inherited Disease

The applications of recombinant DNA technology are exciting and far-reaching. However, the ability to examine the base sequence of an individual raises important ethical questions. Would you want to know that you had inherited a gene that will cause you to die prematurely? Some of you might feel fine about this and decide to live life to the full. We suspect most people would not want to know their fate. But what if you have no choice and DNA testing becomes obligatory should you wish to take out life insurance? In the United Kingdom insurance companies are now able to ask for the results of the test for Huntington's disease. This is a fatal degenerative brain disorder that strikes people in their forties. From the insurance company's point of view DNA testing could mean higher premiums according to life expectancy or at worst refusal of insurance cover. There is much ongoing debate on this issue.

Summary

1. DNA sequences can be cloned using reverse transcriptase, which copies mRNA into DNA to make a hybrid mRNA:DNA double-stranded molecule. The mRNA strand is then converted into DNA by the enzymes ribonuclease H and DNA polymerase. The new double-stranded DNA molecule is called complementary DNA (cDNA).

2. Restriction endonucleases cut DNA at specific sequences. DNA molecules cut with the same enzyme can be joined together. To clone a cDNA, it is joined to a cloning vector—a plasmid or a bacteriophage. Genomic DNA clones are made by joining fragments of chromosomal DNA to a cloning vector. When the foreign DNA fragment has been inserted into the cloning vector, a recombinant molecule is formed.

3. Recombinant DNA molecules are introduced into bacterial cells by the process of transformation. This produces a collection of bacteria (a library) each of which contains a different DNA molecule. The DNA molecule of interest is then selected from the library using either an antibody or a nucleic acid probe.

4. There are many important medical, forensic and industrial uses for DNA clones. These include:

Determination of the base sequence of the cloned DNA fragment
In situ hybridization to detect specific cells making RNA complementary to the clone
Southern blotting and genetic fingerprinting to analyze an individual's DNA pattern
Synthesis of mammalian proteins in bacteria or eukaryotic cells
Changing the DNA sequence to produce a new protein
Generation of fluorescent protein chimeras for subsequent microscopy on live cells

REVIEW QUESTIONS

7.1 Theme: A Mammalian Expression Plasmid

1. Figure 18.13 on shows fluorescent images of human cells containing a chimera of green fluorescent protein and cytochrome c. We tabulate below the steps that the experimenters went through to generate these cells. Identify the elements in the plasmid shown above that allow each step to be performed.

1. DNA encoding cytochrome c is inserted into the plasmid. Which element in the plasmid makes this possible?

2. To generate large amounts of the recombinant plasmid, the plasmid is grown up in bacteria. The plasmid is used to transform competent E. coli which are then cultured in such a way that only bacteria containing the plasmid survive. Which element of the plasmid allows the survival of host bacteria when sister bacteria are dying?

3. The transformed bacteria divide repeatedly, producing colonies each derived from a single transformed progenitor. What element in the plasmid allows it to be copied in parallel with the host bacterium's DNA?

4. Some clones will contain nonrecombinant plasmid, without the cytochrome c insert. However, the recombinant plasmid can be recognised by its higher relative molecular mass. Clones containing the recombinant plasmid are grown up further and then lysed, allowing purification of large amounts of recombinant plasmid. The purified plasmid is then used to transfect human cells, which synthesize the green fluorescent protein:cytochrome c chimaera. Which element in the plasmid allows the chimaeric protein to be expressed in the HeLa cells, even though it was not expressed in the bacteria?

7.2 Theme: Choosing an Oligonucleotide for a Specific Task

2. The first two questions refer to the DNA sequence shown at the bottom of the page. Note that we show only the sequence at the ends of the double-stranded DNA molecule.

A. 5′ TTTTTTTTTTTTTTT 3′

B. 5′ TGCCTACTGCAGCGTCTGCA 3′

C. 5′ TACGGATCCCTTTGCAGGATGAATTC 3′

D. 5′ TTCTGCAGACGCTGCAGTAG 3′

E. 5′ GAATTCTACGGATCCCTTTGCAGGAT 3′

F. 5′ GTGCATCTGACTCCTGTGGAGAAGTCT 3′

G. 5′ GACTGCCATCGTAAGCTGAC 3′

From the above table of DNA sequences, select the one that best fits each of the descriptions below.

1. In the polymerase chain reaction: indicate the oligonucleotide that should be used together with the oligonucleotide 5′ TACGGATCCCTTTGCAGGAT 3′ to amplify the double stranded DNA molecule shown at the bottom of the page.

2. You wish to use the polymerase chain reaction to create, using the double stranded DNA molecule shown at the bottom of the page, a DNA product that can then be cloned into the EcoR1 site of a plasmid. Indicate the oligonucleotide that would you use in place of 5′ TACGGATCCCTTTGCAGGAT 3′ in the PCR reaction mix.

3. An oligonucleotide that could be used to prime the synthesis of DNA from most of the mRNAs present in a tissue, in order to generate a cDNA library.

4. An oligonucleotide that could be used in a Southern blot to identify carriers of sickle cell anemia. Note that this disease is caused because an A in the sequence 5′ GTGCATCTGACTCCTGAGGAGAAGTCT 3′ in the normal β globin gene is mutated to a T to generate the sequence 5′ GTGCATCTGACTCCTGTGGAGAAGTCT 3′.

5. An oligonucleotide that could be used for northern blotting to detect mRNA containing the sequence 5′ GUCAGCUUACGAUGGCAGUC 3′.

5′ TACGGATCCCTTTGCAGGATCCAG—TTCTGCAGACGCTGCAGTAGGCA 3′

3′ ATGCCTAGGGAAACGTCCTAGGTC—AAGACGTCTGCGACGTCATCCGT 5′

7.3 Theme: Uses of cDNA Clones

A. A pair of oligonucleotides, one complementary to a short length of one strand of a DNA molecule, the other complementary to a short length, up to about 4,000 base pairs distant, of the other strand

B. A pair of oligonucleotides, one complementary to a short length of one strand of a DNA molecule, the other complementary to a short length, up to about 4,000 base pairs distant, of the same strand

C. A radiolabelled oligonucleotide complementary to a known sequence within the molecule of interest

D. An oligonucleotide complementary to the bases at the 3′ end of a partially known, but largely unknown, DNA sequence

E. An oligonucleotide complementary to the bases at the 5′ end of a partially known, but largely unknown, DNA sequence

From the above list of oligonucleotides, select the one appropriate for each of the techniques described below.

1. Amplifying a known or partially known DNA sequence using the polymerase chain reaction

2. Automated DNA sequencing by the dideoxy chain termination method

3. Detection of specific DNA sequences by Southern blotting, for example to differentiate DNA from two human subjects

4. Investigation, by northern blotting, of the degree to which a gene of interest is transcribed in a particular tissue

THOUGT QUESTION

You have been provided with a plasmid mixture. Most of the mixture contains the pBluescript plasmid . A small proportion of the mix contains pBluescript into which you have cloned the cDNA for the glucocorticoid receptor cDNA. What can you do to separate from your mix a plasmid that contains the glucocorticoid receptor cDNA?